We narrowed to 2,938 results for: COB
-
Plasmid#60309PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223 SARS-CoV-2 ORF7B C-trunc_nostop
Plasmid#153956PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 11, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 ORF7B C-trunc
Plasmid#153957PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR D-TOPO-C3_10
Plasmid#60259PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertRFX6 enhancer (RFX6 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_25
Plasmid#60268PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertROCK1 enhancer (ROCK1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_31
Plasmid#60310PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_21
Plasmid#60296PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_19
Plasmid#60302PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_MSCV-ires-GFP
Plasmid#237496PurposeRetroviral empty vectorDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V1
Plasmid#222498PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V2
Plasmid#222499PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V3
Plasmid#222500PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V3 (R887E and E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V3 (R887E and E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E and E814…PromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V1
Plasmid#222503PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V2
Plasmid#222505PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-V3
Plasmid#222506PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V3 (R887E and E814G) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V3 (R887E and E814G) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E and E814…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-catΔ
Plasmid#222508PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant catΔ (C706A and R832E) and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant catΔ (C706A and R832E) engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; C706A and R832…PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNES-SET-EMD-EGFP (C-NES-SET-EMD)
Plasmid#217770PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertSET (SET Human)
TagsEGFPExpressionMammalianMutationEMD domain (aa 70-226) plus nuclear export sequen…PromoterCMVAvailable SinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
p2X-KSR1-CA3-EGFP (2x-C-KSR)
Plasmid#217756PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationTwo tandem CA3 domain (aa 317-400) 1st linker GG…PromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CL20_mEGFP_ZKSCAN5_SMO
Plasmid#205960PurposeExpress mEGFP-tagged fusion protein, ZKSCAN5_SMO from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only