We narrowed to 2,675 results for: CCS
-
Plasmid#222309PurposeSynchronize the trafficking of CCR5 from the ER.DepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Str-KDEL_SBP-EGFP-CCR5-Cys3A
Plasmid#222313PurposeSynchronize the trafficking of CCR5-Cys3A from the ER.DepositorInsertStreptavidin-KDEL and CCR5-Cys3A fused to SBP-EGFP (CCR5 Human)
ExpressionMammalianMutationC321A, C323A, C324APromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLeo-B-a2-GEMS(JAK-STAT)
Plasmid#209112PurposeTransient mammalian expression of the CC functionalized GEMS receptor B-a2-GEMS (JAK-STAT)DepositorInsertB-a2-GEMS(JAK-STAT)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLeo-G-a2-GEMS(JAK-STAT)
Plasmid#209113PurposeTransient mammalian expression of the CC functionalized GEMS receptor G-a2-GEMS (JAK-STAT)DepositorInsertG-a2-GEMS(JAK-STAT)
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCR7-DuET
Plasmid#213203PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMR506-EF1a-H2B-EGFP
Plasmid#186627PurposeExpresses nuclear-localised EGFP under EF1a promoter. For insertion of genetic barcodes into 3'UTR of EGFP.DepositorInsertEF1a (EEF1A1 Synthetic)
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
CCR8-DuET
Plasmid#213204PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.PAC
Plasmid#57828PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_EEF1A1_GTP-EFTU
Plasmid#109861PurposeProtein expression and purification of EEF1A1_GTP-EFTUDepositorInsertEEF1A1_GTP-EFTU (EEF1A1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV_CMV_CCR6-Nanoluc-V5
Plasmid#199672Purposeexpresses CCR6-NanoLuc-V5 in mammalian cells, AAV vectorDepositorAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCR6-Tango
Plasmid#66243PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.mNeon
Plasmid#69146PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), mNeon coexpression, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_EEF1A1_GTP-EFTU-D2
Plasmid#109811PurposeProtein expression and purification of EEF1A1_GTP-EFTU-D2DepositorInsertEEF1A1_GTP-EFTU-D2 (EEF1A1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3 CCR5 HHE Short
Plasmid#137697PurposeEncodes region -2761 to -1814 of CCR5 promoter HHE Haplotype fused to firefly luciferaseDepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3 CCR5 HHG Short
Plasmid#137699PurposeEncodes region -2761 to -1814 of CCR5 promoter HHG Haplotype fused to firefly luciferaseDepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Igκ SP-sRECK ΔCK-Fc
Plasmid#246705PurposeExpression vector for secreted human RECK lacking CC domains 1-5, fused to mouse IgG2a FcDepositorInsertRECK (RECK Human)
Tagsmouse IgG2a FcExpressionMammalianMutationΔaa 37-338, ΔGPI anchor signalPromoterCMVAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.GFP
Plasmid#57818PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGPromoterEFS and hU6Available SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only