We narrowed to 14,467 results for: cas9 genes
-
Plasmid#104879PurposeTo generate point mutations using CRISPR/Cas9 system; encoded cytidine deaminase fused to deactived Cas9DepositorInsertCD-dCas9(m4)-UDI
UseCRISPRExpressionInsectAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-HIS3
Plasmid#232093PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Nat
Plasmid#232090PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Kan
Plasmid#232092PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-nCas9n-P2A-TagBFP2-pA
Plasmid#176026PurposeMultisite gateway vector for expression of nCas9n with blue reporter. Parton lab clone ENTDepositorInsertnCas9n-P2A-TagBFP2
UseGateway CloningAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-LSD1-K661A-Hygro
Plasmid#104414Purposetransient expression of dCas9-dLSD1 fusion proteinDepositorInsertdLSD1 (KDM1A Human)
UseCRISPRExpressionMammalianMutationIRATp970A0364D (Source Bioscience) has a P405H ch…PromoterCMV promoterAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
p1194-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIA4_FLAG_NLS
Plasmid#129532PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIA4DepositorInsertscodon-optimized AcrIIA4
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB-VPR-dSpCas9[StaPL(TI)]
Plasmid#111508PurposeExpresses a VPR transcriptional activator fused to the nuclease-deactivated S. pyogenes Cas9, which is governed by an inserted StaPL(TI) module, in mammalian cells. [TI = telaprevir inhibited].DepositorInsertVPR-dSpCas9[StaPL(TI)]
ExpressionMammalianMutationThe HCV NS3 protease carries F43L, Q80K, and S122…PromoterPGKAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cLYN268
Plasmid#188259PurposePlasmid ensures constitutive expression of the C-terminal fragment of split LYN kinase domain (aa 239-267), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cERb447
Plasmid#188257PurposePlasmid ensures constitutive expression of the C-terminal fragment of split ERbeta (aa 447-501), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cTRb413
Plasmid#188261PurposePlasmid ensures constitutive expression of the C-terminal fragment of split TRbeta (aa 413-460), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a6
Plasmid#124860PurposeMutagenesis of Slc17a6DepositorInsertSlc17a6 (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
Plasmid#129530PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3NmeDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRGEB-Cas9-VirD2 (PCO)
Plasmid#139802PurposeExpressing Cas9-VirD fusion under ubiquitin promoterDepositorInsertCas9-VirD2
TagsCas9-VirD2ExpressionPlantPromoterUbiquitinAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDL17_Cas9-His Δcys M1C
Plasmid#206251PurposeBacterial expression of SpCas9 Δcys M1C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationM1C, C80S, C574SPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-EE-UdgX-NG-nCas9-UdgX
Plasmid#163572PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-EE-UdgX-NG-nCas9-UdgX
UseCRISPRExpressionMammalianMutationnCas9 (D10A)EE (R126E, R132E)NG (L111R, D1135V, G…Available SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6-sgR26-eCas9-T2A-BlastR
Plasmid#172493PurposeFor CRISPR-assisted HDR, Rosa26 locusDepositorInserteCas9, BlastR and sgRNA targeting the Rosa26 (R26) safe harbor locus
UseCRISPR, Lentiviral, and Mouse TargetingAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Expression scaffold for dCas9+sgRNA
Plasmid#171799PurposePICASSO: Expression scaffold for second subcloning step to properly co-express paired dCas9-fusion+sgRNADepositorInsertPICASSO: expression scaffold for proper dCas9-fusion + sgRNA expression
UseCRISPRAvailable SinceAug. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags126aa domain from HSV-1 UL12 fused to the N-termi…ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only