We narrowed to 2,981 results for: erf
-
Plasmid#137822Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v8-10 (-cyt) (CD44 Human)
TagsGFPExpressionMammalianMutationwithout cytoplasmic regionPromoterPGKAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNAM-human eIF2C1-B-Myc
Plasmid#50362PurposeExpression of human eIF2C1 mutant in mamalian cellsDepositorAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNAM-human eIF2C1-A-Myc
Plasmid#50361PurposeExpression of human eIF2C1 mutant in mamalian cellsDepositorInserteIF2C1 (AGO1 Human)
TagsmycExpressionMammalianMutationcontains PRP motif and PAZ domainsPromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A32
Plasmid#191241PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A32 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background) (HLA-A Human, Staphylococcus aureus)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceFeb. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A31
Plasmid#191242PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A31 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background) (HLA-A Human, Staphylococcus aureus)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS426-HsFECH
Plasmid#174524PurposeExpresses human ferrochelatase (FECH) in yeastDepositorInsertFECH with yeast HEM15 promoter and terminator (FECH Human, Budding Yeast, Synthetic)
ExpressionYeastMutationLacks original mitochondrial targeting sequence (…PromoterHEM15 (yeast, 257 bp)Available SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-ISG15 C78SN13Y
Plasmid#165106Purposebacterial expressio of a GST fusion of Human ISG15 C78SN13YDepositorInsertISG15 (ISG15 Human)
TagsGST from plasmid.ExpressionBacterialMutationC78SN13Y; The sequence of ISG15-C78S/N13Y contai…Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-CP8B1
Plasmid#191240PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-CP8B1 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), CYP8B1 (CYP12) (predicted interfacial residues of the transmembrane domain in a poly-leu background) (CYP8B1 Human, Staphylococcus aureus)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBig1a zz TEV YBBR POT1 MBP TEV TPP1 MBP TEV TIN2 ZZ TEV TRF2 (4comp2)
Plasmid#185448PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF2 with a zz tag and TEV site, and human TIN2 and TPP1 each with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectMutationSee Depositor Comments BelowAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPe-IFNAR1(28-557)
Plasmid#192785PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
6-ISG-IFN
Plasmid#231488PurposeStandard for type I interferon signature (6 genes)DepositorInsertsUseQpcr plasmid standardMutationpartial sequenceAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196074Purpose(Empty Backbone) Constitutive CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
peDK.11
Plasmid#112150Purpose"Vector DK"DepositorTypeEmpty backboneAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HaloKbp1a
Plasmid#228793PurposeChemigenetic indicator for potassium ion - high affinityDepositorInsertHaloKbp1a
TagsHis-TagExpressionBacterialAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD-HaloKbp1c
Plasmid#228795PurposeChemigenetic indicator for potassium ion - medium affinityDepositorInsertHaloKbp1c
TagsHis-TagExpressionBacterialAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
MFVN-mStayGold(J)
Plasmid#225444PurposeExpresses mStayGold(J) fused to the first 4 amino acids of proinsulinDepositorInsertMFVN-mStayGold(J)
ExpressionBacterialAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6+27-20pf
Plasmid#21978DepositorInsertU6 miR-20 perfect
ExpressionMammalianAvailable SinceNov. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
MFVN-msYFP
Plasmid#218971PurposeExpresses the first 4 aa of proinsulin fused to msYFP in bacteriaDepositorInsertMFVN-msYFP
TagsmsYFPExpressionBacterialAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only