We narrowed to 2,758 results for: ada.2
-
Plasmid#232002PurposeExpression of CHMP2B with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Integrin beta5-2XEGFP
Plasmid#139779PurposeDetecting Integrin beta5 by fluorescence microscopyDepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-eEF2K(S441A/S445A)
Plasmid#110161PurposeExpression of human eEF2K (S441A/S445A) in mammalian cellsDepositorInserteEF2K (eukaryotic elongation factor 2 kinase) (EEF2K Human)
TagsHAExpressionMammalianMutationS441A/S445APromoterCMVAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-TAPBPR-TM
Plasmid#178645PurposeMammalian expression of FLAG-tagged TAPBPR with MHC TMDepositorInsertTAPBPR (TAPBPL Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationswitched transmembrane domain with that of MHC-IPromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2_LPT1
Plasmid#176253PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene and one spacer targeting the LPAAT geneDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short
Plasmid#72552Purposeexpresses 3*FLAG tagged human NSD3-shortDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3*FLAGExpressionMammalianMutationnonePromoterLTRAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6_G
Plasmid#146392PurposeInsect Expression of DmeIF4G-trunc. *Note: this plasmid does not contain an HA-tag as the name implies.DepositorInsertDmeIF4G-trunc (eIF4G1 Fly)
ExpressionInsectMutation322-1666 truncated version of elF4G sequence with…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSG5-FLAG-mEKLF
Plasmid#67833PurposeExpression of FL-EKLF driven by SV40 promoterDepositorInsertEKLF (Klf1 Mouse)
TagsFLAGExpressionMammalianMutationFull-length mEKLF is aa 20-376; amino acid 19 is …PromoterSV40Available SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb1
Plasmid#162793PurposeCcnb1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T2 gp78 G2BR mt / JM26
Plasmid#13308DepositorInsertgp78 (AMFR Human)
TagsGSTExpressionBacterialMutationcDNA corresponds to aa309-643 derived from human …Available SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-gp78 Cue-m1,2 / JM22
Plasmid#13305DepositorInsertgp78 (AMFR Human)
ExpressionMammalianMutationM467G ; F468G ; P469R ; V476R ; D479V ; L480DAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCSIIneo-TRE-hPhyB621- mCherry-HRasCT
Plasmid#139482PurposeExpresses PhyB621-mCherry-HRasCT in mammalian cells.DepositorInsertPhyB621 (PHYB Mustard Weed)
UseLentiviralTagsmCherry-HRasCTExpressionMammalianMutationG229L and deletion of aa Y at position 235 in mch…PromoterTet responsible elementAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-gp78 G2BR mt / JM23
Plasmid#13306DepositorInsertgp78 (AMFR Human)
ExpressionMammalianMutationQ579A ; R580A ; M581A ; L582G ; V583G ; Q584GAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-H741A
Plasmid#238335PurposeproUBI10::VIH2-FL::FLAG-H741A ubiquitous expression in Arabidopsis plantsDepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-C696A
Plasmid#238336PurposeproUBI10::VIH2-FL::FLAG-C696A ubiquitous expression in Arabidopsis plantsDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-K219A-D292A
Plasmid#238331PurposeproUBI10::VIH2-FL::FLAG-K219A-D292A ubiquitous expression in Arabidopsis plantsDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-R372A-H373A
Plasmid#238332PurposeproUBI10::VIH2-FL::FLAG-R372A-H373A ubiquitous expression in Arabidopsis plantsDepositorInsertVIP1 (VIP1 Mustard Weed)
Tags3x Flag-tagExpressionPlantMutationAtVIH2-AtVIH2-R372A-H373AAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-Wild type
Plasmid#238330PurposeproUBI10::VIH2-FL::FLAG-Wild type ubiquitous expression in Arabidopsis plantsDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only