We narrowed to 14,501 results for: SHR;
-
Plasmid#198419PurposeExpresses Human CASP9 Specific gRNA/Cas9 Complex and Reporter ProteinDepositorInsertHuman CASP9 Specific gRNA (CASP9 Human)
UseCRISPRTagsCas9/Orange Fluorescent Protein ReporterExpressionMammalianPromoterU6; CMVAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001147319)
Plasmid#75914Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-CMV-mTagBFP2-2A-FLAG-ntcGAS
Plasmid#102603PurposeLentivector to express Flag-tagged and shRNA-resistant cGAS and mTagBFPDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001148392)
Plasmid#76362Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgVRK1
Plasmid#199638PurposeTamoxifen-inducible expression of sgRNA targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
TGMP.shKras.1422
Plasmid#59913PurposeTet on shKras for conditional Kras knockdownDepositorInsertKras (Kras Mouse)
UseRetroviralAvailable SinceDec. 16, 2014AvailabilityAcademic Institutions and Nonprofits only