We narrowed to 13,309 results for: sequence
-
Plasmid#118586PurposeFor use as a positive control for translation of the Rluc gene in the transfected cells and negative control for replication.DepositorInsertDENV4 Renilla luciferase gene (Rluc) reporter replicon containing replication-defective GND mutation in the NS5 polymerase gene.
UseYeast-e. col shuttle vector prs424MutationThe conserved GDD in the NS5 polymerase gene muta…Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC25A48
Plasmid#131995PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC25A48 (SLC25A48 Human)
ExpressionMammalianAvailable SinceOct. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC30A3
Plasmid#132101PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC30A3 (SLC30A3 Human)
ExpressionMammalianAvailable SinceNov. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFastBac1-His10TEV
Plasmid#159427Purposeempty pFastBac1 vector (polyhedrin promoter) adds TEV-protease-removable N-terminal His10-tag; avoids unwanted residues in the final protein sequence by using the BseRI restriction sitesDepositorTypeEmpty backboneTagsTEV-protease-cleavable His10-tagExpressionInsectPromoterpolyhedrinAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-Flag-53BP1
Plasmid#52507Purposemammalian expression vector of 53BP1DepositorInsert53BP1 (TP53BP1 Human)
TagsFlagExpressionMammalianMutationV128A and siRNA resistant sequence: ACGCGCTGACGAC…PromoterCMV/TOAvailable SinceMarch 26, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCA.66/2272
Plasmid#22733DepositorInsertLox66-pU(delta)TK-EM7Neo-Lox2272
UseCre/Lox; Bac recombineeringMutationThis vector was designed for assembling gene targ…Available SinceDec. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-7guides-PGK-Puro
Plasmid#201960PurposeEBNA episome plasmid for U6 promoter-driven expression of 7 gRNAs targeting miRNA302/367. Includes PGK-puro selection cassetteDepositorInsertMIR302-7g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag Cl-sensitive YFP hNKCC1 WT (NT13)
Plasmid#49060PurposeExpresses human NKCC1 with an N-terminal 3xFlag-YFP-(chloride-sensing) tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFP (chloride-sensitive)ExpressionMammalianMutationCl-sensitive YFP (EYFP/ V163S A206K) in hNKCC1 in…PromoterCMVAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMinDis.X513-iNicSnFR3a-(CC93)-PM
Plasmid#125122PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotine, termed iNicSnFRs thus enabling optical subcellular pharmacokinetics for nicotineDepositorInsertiNicSnFR3a-(CC93)-PM
TagsIg-K-Chain and membrane anchoring sequence-PDGFRExpressionMammalianMutationNAPromoterT7Available SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only