We narrowed to 15,273 results for: grn
-
Plasmid#75577Purpose3rd generation lentiviral gRNA plasmid targeting human NUAK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
SGK3 gRNA (BRDN0001147184)
Plasmid#75542Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148103)
Plasmid#75498Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6_(GLuc)_sgRNA
Plasmid#68422PurposeTransient expression of a minimal sgRNA targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertGluc sgRNA
UseCRISPRExpressionMammalianPromoterhuman U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330_PTEN exon 5 gRNA
Plasmid#68348Purposepx330 with gRNA towards PTEN exon 5. Cas9 is expressed from a CAG promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPTEN exon 5 gRNA
ExpressionMammalianPromoterU6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
Human BLIMP1 sgRNA
Plasmid#59724PurposePlasmid encoding sgRNA to generate BLIMP1 knockout mutant human cellsDepositorInserthBLIMP1 sgRNA
UseCRISPRExpressionMammalianAvailable sinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human SOX17 sgRNA
Plasmid#59725PurposePlasmid encoding sgRNA to generate SOX17 knock-out mutant human cellsDepositorInserthSox17 sgRNA
UseCRISPRExpressionMammalianAvailable sinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human T (BRACHYURY) sgRNA
Plasmid#59726PurposePlasmid encoding sgRNA to generate T (BRACHYURY) knock-out mutant human cellsDepositorAvailable sinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Zebrafish-gRNA-0006
Plasmid#42246PurposegRNA targeted to zebrafish gene rgs4DepositorAvailable sinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0003
Plasmid#42243PurposegRNA targeted to zebrafish gene fh [site #1]DepositorAvailable sinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0002
Plasmid#42242PurposegRNA targeted to zebrafish gene drd3DepositorAvailable sinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
B270 (plasmid expressing ATP1A1 sgSTOP and containing an empty sgRNA-expression cassette)
Plasmid#100716PurposeB52 plasmid expressing ATP1A1 sgSTOP (cloned in BsmBI site) and containing an empty sgRNA-expression cassette (use BbsI for cloning)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgSTOP targeting ATP1A1 (cloned using BsmBI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro hGSDME gRNA1
Plasmid#223519Purposeknocking out hGSDME in human cellsDepositorAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL005-SOX2-sgRNA
Plasmid#175553PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse SOX2 locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspCas9-nuclease and sgRNA against mouse SOX2 STOP Codon
UseMouse TargetingExpressionMammalianAvailable sinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pM115: CasRx control presgRNA
Plasmid#166867PurposeU6-driven expression of control (non-targeting) presgRNA compatible with CasRx.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnon-targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC-CR7T-gRNA2.1-nlsBFP
Plasmid#170515PurposegRNA cloning vector containing a CR7T promoter, gRNA(2.1) scaffold, and a Ubi-mTagBFP-NLS marker; optimized for germline CRISPR.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterCR7TAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSEM253 - sgRNA mosTI hygroR
Plasmid#159827PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertsgRNA mosTI hygroR
ExpressionWormMutationNot applicableAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only