We narrowed to 42,798 results for: gats
-
Plasmid#48854PurposeProvides the At1g04880 terminator as GreenGate module.DepositorInsertAt1g04880 terminator
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGD006
Plasmid#48836PurposeProvides the SV40 nuclear localization signal as GreenGate C-terminal tag module.DepositorInsertSV40 NLS
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGE002
Plasmid#48840PurposeProvides the WUS terminator as GreenGate module.DepositorInsertWUS terminator
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGB006
Plasmid#48823PurposeProvides an ER signal sequence as GreenGate N-terminal tag module.DepositorInsertsignal sequence ER
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGC014
Plasmid#48827PurposeProvides GFP as GreenGate coding sequence module.DepositorInsertGFP
UseGolden gate compatible cloning vectorMutationA206KAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR-221-P3-P4
Plasmid#186351PurposeGateway donor vector with AttP3 AttP4 recombination sitesDepositorTypeEmpty backboneUseGateway donor vectorAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-nLuc
Plasmid#199755PurposeControl construct of elongation reporter to quantify elongation of YFPDepositorInsertNanoluc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGF007
Plasmid#48847PurposeProvides a kanamycin resistance cassette as GreenGate module.DepositorInsertpNOS::KanamycinR::tNOS
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGZ003
Plasmid#48869PurposeEmpty destination vector for creating a GreenGate plant transformation plasmid with the plant resistance cassette at the T-DNA left border.DepositorTypeEmpty backboneUseGolden gate compatible plant transformation vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGZ001
Plasmid#48868PurposeEmpty destination vector for creating a GreenGate plant transformation plasmid with the plant resistance cassette at the T-DNA right border.DepositorTypeEmpty backboneUseGolden gate compatible plant transformation vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGF005
Plasmid#48846PurposeProvides a hygromycin resistance cassette as GreenGate module.DepositorInsertpUBQ10::HygromycinR::tOCS
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pME-TagBFP-NS
Plasmid#75342PurposeMultisite gateway entry clone for adding N-terminal fusions of TagBFPDepositorInsertTagBFP
ExpressionMammalianAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-EGFP-NS
Plasmid#75341PurposeMultisite gateway entry clone for adding N-terminal fusions of EGFPDepositorInsertEGFP
ExpressionMammalianAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGGY001
Plasmid#48866PurposeEmpty destination vector for creating a GreenGate plant transformation plasmid with the plant resistance cassette at the T-DNA right border.DepositorTypeEmpty backboneUseGolden gate compatible plant transformation vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGF003
Plasmid#48844PurposeProvides a D-alanine resistance cassette as GreenGate module.DepositorInsertpMAS::D-AlanineR::tMAS
UseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGY003
Plasmid#48867PurposeEmpty destination vector for creating a GreenGate plant transformation plasmid with the plant resistance cassette at the T-DNA left border.DepositorTypeEmpty backboneUseGolden gate compatible plant transformation vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGGA004
Plasmid#48815PurposeProvides the 35S promoter as GreenGate module.DepositorInsert35S promoter
UseGolden gate compatible cloning vectorMutationinternal BsaI recognition site removed by substit…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR-221-P3-P5
Plasmid#186350PurposeGateway donor vector with AttP3 AttP5 recombination sitesDepositorTypeEmpty backboneUseGateway donor vectorAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only