We narrowed to 2,579 results for: pcas
-
Plasmid#117522PurposeLevel0 Golden Gate part: CDS, SpCas9-p (no stop codon)DepositorInsertSpCas9-p (no stop codon)
UseCRISPRAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICSL90005
Plasmid#117520PurposeLevel0 Golden Gate part: CDS, SpCas9-h (no stop codon)DepositorInsertSpCas9-h (no stop codon)
UseCRISPRAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0049
Plasmid#117616PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for SpCas9-h(pICSL11023) and sgRNA_AtMPK19 {AT3G14720}(pEPOR1CB0081)DepositorInsert[35S:SpCas9-h(pICSL11023) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT35
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH3.3-GS3
Plasmid#204764PurposeExpression of Cas9 and human H3.3DepositorInsertH3.3
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
ipGL2Cas
Plasmid#210555PurposeBinary vector expressing the estradiol-inducible Lineage Tracing system. XVE expression driven by GL2 promoter.DepositorInsertGL2p::XVE::UBQ10t::LexA::SpCas9::PEA3AT::VenusSSM
ExpressionPlantAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA1.1
Plasmid#208298PurposeExpresses ABE-RA1.1 in mammalian cellsDepositorInsertTadA-RA1.1-SpCas9 D10A
ExpressionMammalianMutationD108G, K161NAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
UAS-GFP::NMN-Deamidase{dead}
Plasmid#187869PurposeGal4/UAS expression of GFP::NMN-Deamidase(dead)DepositorInsertNMN-Deamidase{dead}
TagsGFPExpressionBacterialAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::axed{sgRNA})
Plasmid#187883PurposeGal4/UAS sgRNA expression targeting axedDepositorInsert4 sgRNAs targeting axed
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::hiw{sgRNA})
Plasmid#187884PurposeGal4/UAS sgRNA expression targeting hiwDepositorInsert4 sgRNAs targeting hiw
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::dsarm{sgRNA})
Plasmid#187885PurposeGal4/UAS sgRNA expression targeting dsarmDepositorInsert4 sgRNAs targeting dSarm
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pITI2
Plasmid#166095PurposeGal inducible expression of D10A-Cas9 nickaseDepositorInsertCas9-D10A
UseCRISPRExpressionYeastMutationspCas9-D10APromoterGal-inducibleAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPH3
Plasmid#166098PurposeGal inducible expression of D10A-Cas9 nickaseDepositorInsertCas9-D10A
UseCRISPRExpressionYeastMutationspCas9-D10APromoterGal-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
MTF2_KO_ex11_gRNA-4
Plasmid#131334PurposegRNA to knockout MTF2. This gRNA is also used in Haojie Li et al. Nature 2017. It targets exon 11 of MTF2.DepositorInsertMTF2_KO_ex11_gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL1211
Plasmid#129521PurposepDEF-SpCas9::GFP, For deletion of pyalba4, PyGAPDH promoter, 2nd GenerationDepositorInsertSpCas9
UsePlasmodium, rodent-infectious speciesTags3XFlag-NLSAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA B
Plasmid#127905PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA A
Plasmid#127904PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only