We narrowed to 2,323 results for: hells
-
Plasmid#165422PurposeA Golden Gate (MoClo) compatible Level 2 acceptor binary vector based on pGreenII (Hellens et al., 2000).TypeEmpty backboneUseSynthetic Biology; Level 2 golden gate (moclo) du…PromoterContain GG cassette and MCS with LacZ for blue/wh…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-Sst12-GFP
Plasmid#172311PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneuronsDepositorInsertSst12
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPSup_35Senh(fwd)_35Spr+synJ
Plasmid#149422PurposePlasmid for STARR-seq in tobacco leaves. The GFP reporter gene is under the control of a 35S minimal promoter and an upstream 35S core enhancer.DepositorInsert35S core enhancer
ExpressionPlantAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst22-GFP
Plasmid#172312PurposeSST interneuron-restricted gene regulatory element GRE22, to drive GFP expression in SST+ interneuronsDepositorInsertSst22
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2SCb
Plasmid#59385PurposeTemplate plasmid for amplification of a selection cassette that includes two transcription terminator elements, an I-SceI site and a modified chloramphenicol resistance gene.DepositorInsertTT-ISceI-cat2
UseTemplateMutationThe 3’-end of the chloramphenicol resistance gene…Available SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
Flag-TRIM24-C840W
Plasmid#28136DepositorAvailable SinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDY-HA1-HA2-neo
Plasmid#109123PurposeFR cassette provider to introduce FR cassette to a BAC by recombineeringDepositorInsertsHA1
HA2
Available SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GW-V5-Hygro
Plasmid#68265PurposeConstitutive selectable expression of C-term V5 tagged proteinsDepositorTypeEmpty backboneTagsV5ExpressionMammalianPromoterCAGAvailable SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVSr-GhOMT1
Plasmid#234932PurposeThis virus-induced gene silencing (VIGS) reporter vector is used to evaluate the silencing of GhOMT1 geneDepositorInsertPartial coding region sequence of GhOMT1
ExpressionPlantAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVSr-GhPDS
Plasmid#234931PurposeThis virus-induced gene silencing (VIGS) reporter vector is used to evaluate the silencing of GhPDS geneDepositorInsertPartial coding region sequence of GhPDS
ExpressionPlantAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXD70EN19-Pct5-GPA_25810/25800-(+)-Eldh1/2(GpDSM19378)
Plasmid#225305PurposeExpresses Gordonibacter pamelaeae DSM 19378 (+)-Eldh1 and (+)-Eldh2 in Eggerthella lenta DSM 2243 with a cumate inducible promoterDepositorInsert(+)-Eldh1, (+)-Eldh2
ExpressionBacterialAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
iNos-eGFP
Plasmid#207251PurposeReporter for expression of eGFP under control of iNos promoterDepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-Kif5c
Plasmid#71853Purposemammalian expression of GFP-Kif5cDepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDuBir-Lbu-dCas13a-avitag
Plasmid#100817PurposeDual expression of Lbu-dCas13a with a C-terminal avi-tag and BirA to biotinylate Lbu-dCas13aDepositorInsertLbu_Cas13a_R472A_H477A_R1048A_H1053A
TagsAviTag and His6-MBPExpressionBacterialMutationR472A, H477A, R1048A, H1053APromoterT7Available SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY118A
Plasmid#182958PurposepSC101 ori, chl34 resistant. Cas9 induced at 0.4 μg/ml anhydrotetracycline, recombineering proteins induced by a 15 min heat-shock at 42°C, I-Scel (induced by 0.1 mM IPTG) is to cleave the pDonor2.DepositorInsertsCas9
Gam, Beta, Exo
I-scel
Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-TRIM24-C840W shRescue
Plasmid#28137DepositorInsertTRIM24 (TRIM24 Human)
TagsFLAGX2ExpressionMammalianMutationC840Wmutated at aa 308 and 309 for shRNA rescue; …Available SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO-NES
Plasmid#238918PurposeMammalian expression of DAAO with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO-NES
UseAAVExpressionMammalianPromoterCaMKIIalfaAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-Kif5cmut
Plasmid#71854Purposemammalian expression of mutant GFP-Kif5cDepositorInsertKif5c (Kif5c Rat)
TagsEGFPExpressionMammalianMutationT93N mutation and also a novel SpeI site (1652). …PromoterCMVAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only