We narrowed to 14,467 results for: cas9 genes
-
Plasmid#78606PurposepZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2DepositorInsertCMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoter173CMV, U6Available SinceDec. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:VPR:Tnos (GB1826)
Plasmid#160623PurposeTU for the constitutive expression of dCas9 fused to VPR (VP64-p65-Rta) activation domainsDepositorInsertP35S:dCas9:VPR-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
Plasmid#68345PurposeA Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expressionDepositorInsertspuromycin
hCas9
UseCRISPR; Flp/frtTagslinked to red flouresent protein gene mKateII and…ExpressionMammalianPromoterCAGAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSH231-EF1-BLST-Cas9-VPR
Plasmid#115147PurposeSafe harbor site 231 knock-in vector with BlastR-Cas9-VPR expression cassetteDepositorInsertBlastR-P2A-Cas9-VPR
UseCRISPRTagsSV40NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9
Plasmid#87917PurposeGateway cloningDepositorInsertsgHTT1, sgGFP2, shCas9
ExpressionMammalianPromoterH1, U6, 7SKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBS-Nvec-codonopti-Cas9-2xNLS
Plasmid#141108PurposePlasmid containing insert for the IVT of nuclear localized Cas9 mRNA with codon optimization for Nematostella vectensisDepositorInsertNematostella codon optimized Cas9
UseUnspecifiedMutationAll amino acids coded for by codons optimized for…PromoterT7Available SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-CBP core
Plasmid#179560Purposeencodes S. pyogenes dCas9 with both n-terminal and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-CjeCas9-sgRNA (KAC482)
Plasmid#133793PurposeU6 promoter sgRNA entry vector used for all CjeCas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V2-TGAA linker sgRNA architecture from Kim et al. Nature Communications 2017DepositorInsertCjeCas9 sgRNA entry vector
ExpressionMammalianMutationV2-TGAA linker sgRNA architecture from Kim et al.…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSaCas9-KRAB(Zim3)-pA
Plasmid#255030PurposeAAV plasmid encoding a dSaCas9-KRAB(Zim3) fusion gene controlled by a CMV promoterDepositorInsertdSaCas9-KRAB(Zim3)
UseAAV and CRISPRAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-ABE8e-nSpCas9-Intergenic sgRNA
Plasmid#237463PurposeAll-in-one base editor expressing adenine base editor (ABE8e-nSpCas9) and gRNA control targeting Intergenic siteDepositorInsertIntergenic sgRNA
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9-Intergenic sgRNA
Plasmid#237464PurposeAll-in-one base editor expressing cytosine base editor (evoCDA1-nSpCas9) and sgRNA control targeting Intergenic siteDepositorInsertIntergenic sgRNA
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX462-ABE8e-nSaCas9-Intergenic sgRNA
Plasmid#237465PurposeAll-in-one base editor expressing adenine base editor (ABE8e-nSaCas9) and sgRNA control targeting Intergenic siteDepositorInsertIntergenic sgRNA
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-ABE8e-nSpCas9-NRF1-ss-sgRNA
Plasmid#237466PurposeAll-in-one adenine base editor (ABE8e-nSpCas9) with gRNA targeting NRF1-Ex7 splice siteDepositorInsertgRNA targeting NRF1-Ex7 splice site
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9-NRF1-ss-sgRNA
Plasmid#237467PurposeAll-in-one cytosine base editor (evoCDA1-nSpCas9) with sgRNA targeting NRF1-Ex7 splice siteDepositorInsertsgRNA targeting NRF1-Ex7 splice site
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX462-ABE8e-nSaCas9-NRF1-ss-sgRNA
Plasmid#237468PurposeAll-in-one adenine base editor (ABE8e-nSaCas9) with gRNA targeting NRF1-Ex7 splice siteDepositorInsertgRNA targeting NRF1-Ex7 splice site
UseCRISPRExpressionMammalianPromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-BRD4-HaloTag-Guide-hspCas9
Plasmid#228576PurposeExpression of Halo-tagged human BRD4 gRNA; CRISPR-mediated gene insertionDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L3-Csy4-FokI-dCas9-EGFP-L2
Plasmid#141047PurposeMutisite Gateway mediated vector constructionDepositorInsertCsy4-2A-FokI-dCas9-2A-EGFP
ExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only