We narrowed to 20,409 results for: RAN-1
-
Plasmid#177055PurposeMoClo Level 1, position 3, transcriptional unit for transient expression of 7-deoxyloganetic acid glucosyl transferase (Cr7-DLGT) from Catharanthus roseus driven by 35S promoterDepositorInsert7-deoxyloganetic acid glucosyl transferase (Cr7-DLGT) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0787
Plasmid#177072PurposeMoClo Level 1, position 4, transcriptional unit for transient expression of geraniol synthase (CrGES) from Catharanthus roseus promoter regions contains 4x attB sites for recruitment fo gal4AD-phiC31DepositorInsertgeraniol synthase (CrGES) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-Hybrid-caspase_human-caspase-4-CARD+canine-Caspase-1/4-catalytic domain
Plasmid#183397PurposeExpression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCARD domain of human caspase-4 fused to catalytic domain of canine caspase-1/4
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-Hybrid-caspase_mouse-caspase-11-CARD+canine-Caspase-1/4-catalytic domain
Plasmid#183398PurposeExpression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCARD domain of mouse caspase-11 fused to catalytic domain of canine caspase-1/4
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
TNPO1-shRNA
Plasmid#86082PurposeA lentiviral construct for building stable cell lines expressing Transportin-1 shRNA via puromycin selection.DepositorAvailable SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0796
Plasmid#177074PurposeMoClo Level 1, position 4, transcriptional unit for transient expression of 8-hydroxygeraniol oxidoreductase (CrGOR) from Catharanthus roseus promoter regions contains 4x attB sites for recruitment fo gal4AD-phiC31DepositorInsert8-hydroxygeraniol oxidoreductase (CrGOR) from Catharanthus roseus
UseSynthetic BiologyAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHCAG-L2EOP
Plasmid#51783PurposeThe oriP/EBV nuclear antigen (EBNA)-1 elements of Epstein-Barr virus is fused in frame with the luciferase in the herpes simplex virus type-1 amplicon vector, provides prolonged transgene expressionDepositorInsertsLuciferase-2A-EBNA-1
OriP
UseHerpes simplex virus type-1 amplicon vectorPromoterCAGAvailable SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (mut - miR-21 site1)
Plasmid#62580PurposeTranslational Luciferase Reporter encoding a mutated fragment of the SPRED1 3'UTR. The upstream miR-21 (site 1) binding site was mutated.DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseMutationmiR-21 binding site 1 mutant (TAAGCTA --> TAGA…Available SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
Mucolipin1 D471-472K-pHcRed C1
Plasmid#62961Purposefull length human Mucolipin-1 D471/472K cloned into pHcRed1 C1DepositorInsertMucolipin-1 (MCOLN1 Human)
TagsHcRedExpressionMammalianMutationD471/472K (and two silent mutations T77 ACA inst…PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8 Flag3HuR
Plasmid#135950PurposeExpresses HuR in mammalian cells. Can also be used to generate mRNA for zebrafish expression.DepositorAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSFV_Nb139-NLS-VP64 (3'UTR)_RLEloop
Plasmid#240256PurposeAttenuated PROTEUS vector with Nb139-VP64 transgene. Package VLVs with an envelope-expressing vector such as pCMV-VSV-G, or a transgene-responsive VSV-G expression vector.DepositorInsertnanobody Nb139
TagsNLS-VP64ExpressionMammalianMutationVP64 = 4*VP16[aa437-447]PromoterSFV subgenomic promoterAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
L4804 VEGFR1 CTEVp chain in PolyTX-mTagBFP2
Plasmid#244174PurposeConstitutive expression of a MESA CTEVp chain encoding (N to C): VEGFR1SS-3xFLAG-VEGFR1ECD-VEGFR1TMD-CTEVp(190K)-PRS(M)-VP64-ZF6DepositorInsertMESA CTEVp chain with human VEGFR1 SS, ECD and TMD, CTEVp (190K), TEVp PRS (M in P1'), and synTF (VP64-ZF6) (FLT1 Human, Synthetic)
UseSynthetic BiologyTagsVEGFR1 signal peptide - 3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mTagRFP-T-Rab4a-7
Plasmid#58025PurposeLocalization: Ras GTPase, Excitation: 555, Emission: 584DepositorAvailable SinceNov. 4, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKrox24(MapERK)d1EGFP (KroxDs)
Plasmid#214912Purposefor PiggyBac mediated integration and stable expression of destabilised EGFP as a reporter to MAPK/ERK pathway activationDepositorInsertd1EGFP under the MapERK promoter
ExpressionMammalianPromoterMapkERK promoterAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF2242
Plasmid#141986PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
TRS6E1b-luc(-732/-721) mutant 4
Plasmid#45387DepositorInsert6 copies of hPAI-1 promoter -732/-721 four point mutation (SERPINE1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationmutated from agacaaggttgt to acactaggatgaAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
TFORF1690
Plasmid#143967PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1920
Plasmid#142887PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only