We narrowed to 14,172 results for: cas9
-
Plasmid#104994PurposeThis 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
cBEST3
Plasmid#234659PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and kasO17tssAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJWV102-PL-dCas9
Plasmid#85588PurposeIntegrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9spDepositorInsertdCas9sp
UseCRISPRExpressionBacterialPromoterPLspAvailable SinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
G9A[SET]-dCas9
Plasmid#100089PurposeCatalytic domain [SET] of human G9A fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertG9A (EHMT2 Human)
UseCRISPRTags3XFLag-NLS-G9A[SET]-dCas9-NLSExpressionMammalianMutationG9A[SET] includes aa 829-1209PromoterCMVAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag3-gRNA3
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2T-gRNA2
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-HypaCas9
Plasmid#108302PurposepX330 (Plasmid #42230) with the N692A, M694A, Q695A, and H698A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC149-pCR8-dCas9VP160
Plasmid#48221PurposedCas9VP160 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorInsertdCas9(D10A;H840A) fusion with VP160 activation domain
UseCRISPR and Gateway CloningTagsHA Tag and VP160MutationD10A;H840A nuclease-deficientAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAC91-pmax-dCas9VP64
Plasmid#48223PurposedCas9VP64 on pmax expression vectorDepositorInsertdCas9(D10A;H840A) fusion with VP64 activation domain
UseCRISPRTagsHA Tag and VP64ExpressionMammalianMutationD10A;H840A (catalytically inactive)PromoterCAGGSAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pICH41308::hCas9
Plasmid#49770PurposeLevel 0 hCas9 moduleDepositorInserthCas9
UseCRISPRAvailable SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
SlugCas9-HF
Plasmid#163796PurposeExpresses highly specific SlugCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianMutationSlugCas9 (R247A, N415A, T421A, R656A)Available SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_dCas9-XTEN-KRAB-p2A-mCherry
Plasmid#222107PurposeDonor vector for CRISPRi integration at AAVS1 with an mCherry fluorophoreDepositorInsertCRISPRi-kox1(KRAB) (cas9 Human, S. pyogenes)
UseAAV and CRISPRTagsHA and P2A-mCherryExpressionMammalianMutationD10A, H840AAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG
Plasmid#179081PurposeNOTE: An improved version of this plasmid is now available. See Addgene plasmid #242072. All-in-one prime editor piggyBac transposon, SpG variantDepositorInsertSpCas9 SpG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135L, S1136W, G1218K, E1219Q, R1335Q, T1337RPromoterCAGAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pyEvolvR (enCas9-PolI5M)
Plasmid#158073PurposeExpresses enCas9 fused to PolI5M in S. cerevisiae; contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI5M
ExpressionBacterial and YeastAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
SUV[SET]-dCas9
Plasmid#100088PurposeCatalytic domain [SET] of human SUVAR39H1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertSUVAR39H1 (SUV39H1 Human)
UseCRISPRTags3XFLag-NLS-SUV[SET]-dCas9-NLSExpressionMammalianMutationdeleted aa 1-76PromoterCMVAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tet1-dCas9
Plasmid#136650PurposeTet1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertTet1 (Tet1 Mouse)
UseCRISPRTags3XFLag-NLS-Tet1-dCas9-NLSExpressionMammalianPromoterCMVAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only