We narrowed to 3,396 results for: guide rna expression plasmid
-
Plasmid#219823PurposeEF1α-driven expression of RfxCas13d in mammalian cells. For cloning of pre-guide RNAs compatible with RfxCas13d. Contains a 5' direct repeat. Clone using BsmBI. (Adapted from plasmid #138147)DepositorInsertRfxCas13d
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1a core promoterAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
mLama1 AAV sgRNA 1, 2, 5
Plasmid#135339PurposeExpression plasmid of VP64-SadCas9 sgRNA 1, 2 and 3DepositorInsertLama1 VP64-dCas9 sgRNA Guides
UseAAVTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
Plasmid#60230PurposeExpresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
EGFP
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA-P2A and EGFP-KASHExpressionMammalianMutationPromoterU6 and hSynAvailable sinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
gRNA-HEK3-Puro
Plasmid#136282PurposeExpresses a guide RNA targeting HEK3 siteDepositorInsertsgRNA-HEK3
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMammalianMutationPromoterU1a and U6Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-tevopreQ1-epegRNA+13C>A_EF1a-puroR (PBS 10 - RTT 19)
Plasmid#207357PurposeLentiviral transfer plasmid encoding hU6-driven expression of a L227R-CFTR correcting prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR + 13 C>A tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-tevopreQ1-epegRNA+13C>G_EF1a-puroR (PBS 14 - RTT 18)
Plasmid#207356PurposeLentiviral transfer plasmid encoding hU6-driven expression of a N1303K-CFTR correcting prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR + 13 C>G tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU3-gRNA
Plasmid#53063PurposeTranscription of guide RNA (gRNA) in rice cellsDepositorInsertOsU3 promoter + gRNA scaffold
UseCRISPR; Plant expressionTagsExpressionMutationPromoterrice U3Available sinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSG1C3
Plasmid#164423Purposesingle guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterU6Available sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorInsertCreb5 gRNA (CREB5 Bovine)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 and hPGKAvailable sinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149212)
Plasmid#77051Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorInsertRNASEL (RNASEL Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001149358)
Plasmid#77052Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorInsertRNASEL (RNASEL Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001146030)
Plasmid#77053Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorInsertRNASEL (RNASEL Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RNASEL gRNA (BRDN0001148937)
Plasmid#77054Purpose3rd generation lentiviral gRNA plasmid targeting human RNASELDepositorInsertRNASEL (RNASEL Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianMutationPromoterAvailable sinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHExpressionMutationPromoterEF1a and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1089: mini-AAV.sgRNA.Nme2Cas9
Plasmid#159536PurposeDelivery of Nme2Cas9 and its sgRNA in a single AAV vector with overall packaging size of 4.4 KbDepositorInsertNme2Cas9 with single guide RNA cassette
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianMutationPromoterU1aAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAN012
Plasmid#220051PurposeReporter plasmid that expresses GFP and firefly luciferase linked with a viral 2A peptide (positive control).DepositorInsertGFP-fLuc
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only