We narrowed to 4,689 results for: crispr c plasmids
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
pXD71Cas10RFP-Pct5.1-crRNA(AarI)-RFP
Plasmid#192273PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(AarI)-RFP, entry plasmid for crRNA cloningDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.0-Pct5.1-crRNA(AarI)
Plasmid#191633PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(nontargeting spacer), entry plasmid for crRNA cloningDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRAC_DARIC(2-3)_CD22-BBz_AAV6_Donor
Plasmid#211906PurposeVector for AAV6 donor production. Targeted CD22-BBz DARIC transgene integration to the TRAC locus via homology-directed repair.DepositorInsertDARIC-CD22-BBz
UseAAVExpressionMammalianAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_CV2
Plasmid#167165PurposepgRNA_CV2 is derived from gRNA_cloning vector (Addgene plasmid ID: 41824) by adding about 80 bps from the sgRNA sequence as well as an AgeI site. In the literature, sgRNA_AL is used as an alias.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9 fused to nanobody (anti-beta catenin)
Plasmid#186420PurposeExpression of dCas9 with C-terminal nanobody fusion recognizing beta catenin tagDepositorInsertdCas9-nanobody fusion (anti-beta catenin)
UseCRISPRTags6HisAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
Plasmid#208111PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA scaffold by U6 promoterDepositorInsertSpG C, U6, scaffold
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)
Plasmid#47868PurposeThis plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter.DepositorInsertsNmCas9
U6pr-tracrRNA
UseCRISPRTagsHA and NLSExpressionMammalianPromoterEF1a and U6Available SinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMb3Cas12a-NLS(nucleoplasmin)-3xHA (RTW2500)
Plasmid#115142PurposeCAG promoter expression plasmid for human codon optimized Mb3Cas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized Mb3Cas12a
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-petRNA
Plasmid#181802PurposepetRNA cloning plasmidDepositorInsertpetRNA-Kan
UseCRISPRAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP608-1
Plasmid#99484PurposeH2B::linker::GFP (contain 3 introns)::3XFlag::TEV::Myc::tbb-2 3UTRDepositorInsertH2B::linker::GFP with introns::3XFlag::TEV::Myc::tbb-2 3UTR
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only