We narrowed to 20,934 results for: OMP
-
Plasmid#130646PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene. The mutated right end introduces an MmeI recognition site (used for Tn-seq). Total transposon size = 977 bp.DepositorInsertVchCAST donor DNA (R*)
UseCRISPR; TransposonExpressionBacterialMutationTGTTGATA --> TGTTGGAAAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP1a_G
Plasmid#146400PurposeMammalian Expression of HsDcp1aDepositorInsertHsDcp1a (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
ST-SBP-EGFP_puromycin
Plasmid#65270PurposeST reporter only ( no hook) (RUSH system)DepositorInserttruncated sialyltransferase (ST6GAL1 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianMutationcontains only amino acids 1 to 43 of STPromoterCMVAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-HsNot4-GB1His6_AG
Plasmid#148792PurposeBacterial Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
ExpressionBacterialMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
Plasmid#210504Purposeexpresses NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry component in mammalian cellsDepositorInsertNES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
ExpressionMammalianAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
TagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PatoM-LOG241
Plasmid#72847PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. LOG241 backbone.DepositorInsertPatoM
ExpressionBacterialPromoterPatoMAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
His-MBP-NRBF2 (1-159)
Plasmid#99331PurposeMammalian expression of the monomeric form of NRBF2 that binds with the PI3K C1 complexDepositorInsertNuclear receptor-binding factor 2 (NRBF2 Human)
Tags6xHis-MBP-TEVExpressionBacterialMutationAA1-159 are presentPromoterT7Available SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_H2B-SiR-tag-T2A-mEGFP
Plasmid#249668PurposeCo-expression of silicon rhodamine-binding protein tag (nuclear) and mEGFP (not localized) in mammalian cellsDepositorInsertH2B-SiR-tag-T2A-mEGFP
ExpressionMammalianAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-CCR5
Plasmid#222309PurposeSynchronize the trafficking of CCR5 from the ER.DepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGGI_Myr-YFP-MiniTurboID
Plasmid#222432PurposePotential plasma membrane control.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker, Myr, and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT4_short_mCherry2-NLS-PEST_Puro
Plasmid#213774PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT4_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT4_mCherry2-NLS-PEST_Puro
Plasmid#213773PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT4_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT3_short_mCherry2-NLS-PEST_Puro
Plasmid#213772PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT3_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT2_mCherry2-NLS-PEST_Puro
Plasmid#213769PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT2_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT2_short_mCherry2-NLS-PEST_Puro
Plasmid#213770PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT2_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT1_mCherry2-NLS-PEST_Puro
Plasmid#213767PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT1_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT1_short_mCherry2-NLS-PEST_Puro
Plasmid#213768PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT1_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only