We narrowed to 10,599 results for: cat.1
-
Plasmid#173853PurposeProtein expression plasmid for recombinant His-Myc tag mouse PLD3DepositorInsertPLD3 (Pld3 Mouse)
UseTags6xHis, Myc, Factor X cleavableExpressionMammalianMutationintracellular and transmembrane domain truncated,…PromoterCMVAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGMβ1
Plasmid#216202PurposeChromosomal gene manipulation (gene insertion, conversion, deletion) of dairy used Lactobacillus bulgaricus, a difficult gene to manipulate, is now possible by conjugation using this pGMB1 plasmid.DepositorTypeEmpty backboneUseShuttle vector, conjugal plasmid, theta type rep…TagsExpressionBacterialMutationPromoterlac promoter in pGEM-Teasy, Promoters in pAMbeta1…Available sinceJan. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP926
Plasmid#135001Purposem6A Reader-Writer. Propagates Gm6ATC along GATC arrays as well as across cell generations. pUBC-DpnI(aa146-254)-3xFLAG-Dam(R95A) pGK-HygroRDepositorInsertpUBC-DpnI(aa146-254)-3XFLAG-Dam(R95A) pGK-HygroR
UseLentiviral and Synthetic BiologyTags3xFLAG, Dam(R95A), and DpnI(aa146-254)ExpressionMammalianMutationDpnI domain truncated to aa146-254. Dam protein m…PromoterAvailable sinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterJ23119 and lac promoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9-AIDx
Plasmid#135343PurposeExpression of wildtype nSpyCas9 encoding truncated human cytosine deaminase, hAIDx, at the C-terminus.DepositorInsertnSpyCas9-hAIDx
UseCRISPRTagsExpressionMammalianMutationWTPromoterAvailable sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
D28 Cortactin GFP
Plasmid#26723DepositorInsertCortactin (Cttn Mouse)
UseTagsEGFPExpressionMammalianMutationDeletion removed 28 amino acids (aa# 334-361) enc…PromoterAvailable sinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-deGFP
Plasmid#184840PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the mRNA of deGFP and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the the mRNA of deGFP, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterJ23119 and lac promoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
YCe2741 HC_Kan_EF1ap_p18
Plasmid#100698Purposepart designed to occupy position 18 of EMMA. Functional category: Constitutional promoterDepositorInsertEF1a promoter (EEF1A1 Human)
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BCL6-t2A-BCL2
Plasmid#135305PurposeOverexpression of multiple human genes (BCL2 and BCL6)DepositorUseRetroviralTagsExpressionMutationPromoterLTRAvailable sinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12D/sgKras/Cre
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12C/sgKras/Cre
Plasmid#99850PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12V/sgKras/Cre
Plasmid#99854PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13D/sgKras/Cre
Plasmid#99857PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12S/sgKras/Cre
Plasmid#99853PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13V/sgKras/Cre
Plasmid#99860PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_LCLAT1_GREB10
Plasmid#205845PurposeExpress mEGFP-tagged fusion protein, LCLAT1_GREB1 from patient-derived sequenceDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLdCN2
Plasmid#125186PurposeExpresses Streptococcus pyogenes Cas9 (SpCas9) and two gRNAs in LeishmaniaDepositorInsertgRNA and Cas9
UseCRISPR; LeishmaniaTagsExpressionMutationPromoterAvailable sinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAM5404
Plasmid#132660PurposeRSF1010-based broad host-range plasmid with additional RK2 bom siteDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM5406
Plasmid#132661PurposeRSF1010-based broad host-range plasmid with additional RK2 bom site and pUC originDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4046660
Plasmid#149214PurposeYeast Expression plasmid for SARS-CoV-2 nsp2DepositorInsertSARS-CoV-2 nsp2 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Budding Yeast)
UseTagsExpressionYeastMutationSaccharomyces cerevisiae recode 1PromoterpTEF1Available sinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046689
Plasmid#149212PurposeYeast Expression plasmid for SARS-CoV-2 nsp6DepositorInsertSARS-CoV-2 nsp6 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Budding Yeast)
UseTagsExpressionYeastMutationSaccharomyces cerevisiae recode 1PromoterpTEF1Available sinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pWD509
Plasmid#73739PurposeGateway compatible [1-2] Entry Vector encoding 2xNLS-FLP-D5DepositorInsert2xNLS-FLP-D5
UseTagsExpressionWormMutationG5DPromoterAvailable sinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-