We narrowed to 4,337 results for: U6 gRNA
-
Plasmid#157986PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Loop2-8A8G)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Loop2-8A8G
Plasmid#157983PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Loop2-8A8G)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-tRNA-Tail-8A8G
Plasmid#157984PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Tail-8A8G)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-tRNA-Tetra Loop-8A8G
Plasmid#157985PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Tetra-8A8G)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Tail-8A8G
Plasmid#157981PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tail-8A8G)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Tetra Loop-8A8G
Plasmid#157982PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tetra-8A8G)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA Pol III)Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSc1-DD
Plasmid#80439PurposeExpresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRTagsE. coli dihydrofolate reductaseExpressionMammalianMutationPromoterCMV and U6Available sinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJJR50
Plasmid#75026PurposeU6 promoter driven flipped + extended sgRNA expression vectorDepositorInsertguide RNA, flipped and extended version
UseCRISPRTagsExpressionMutationPromoterR07E5.16 (U6)Available sinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide_DKO
Plasmid#183193PurposePlasmid with two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6, mU6Available sinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6, mU6Available sinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXM1_iso1_2
Plasmid#135753PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorInsertFOXM1_iso1 gRNA (FOXM1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXM1_iso1_1
Plasmid#135752PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorInsertFOXM1_iso1 gRNA (FOXM1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pICH41331::pU6cm-pegR::EURb7
Plasmid#227695PurposeGolden Gate level 0 acceptor vector for cloning altered epegRNA: altered epegRNA being driven by U6 composite promoter (pU6cm) and terminated by a dual terminator (EURb7).DepositorInsertAltered epegRNA backbone with cloning sites for gRNA and RTT.
UseCRISPRTagsExpressionPlantMutationPromoterU6 compositeAvailable sinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGC-Lb12-P1Bb
Plasmid#231387PurposeFor crRNA cloning with LbCas12a vectors for genome editing in ArabidopsisDepositorInsertU6-29
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-HD118
Plasmid#172655PurposeExpressing paired pegRNAs from human U6 and H1 promoters to make 118-bp deletion on HPRT1 geneDepositorInsertpegRNA-HD118A/pegRNA-HD118B
UseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'UAG)
Plasmid#170128PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'UAG)-MS2
UseLentiviralTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR/eCas9-GPIDAF
Plasmid#213710PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of eCas9 and the affinity sorting tag TST-EGFP-GPIDAF under separate promoters.DepositorInsertEGFP
UseCRISPRTags3XFLAG and Twin-strep-tagExpressionMutationPromoterCMVAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR/eCas9-GPIBY55
Plasmid#213709PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of eCas9 and the affinity sorting tag TST-EGFP-GPIBY55 under separate promoters.DepositorInsertEGFP
UseCRISPRTags3XFLAG and Twin-strep-tagExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only