We narrowed to 522 results for: lenti crispr v2
-
Plasmid#201599PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertHNRNPD (HNRNPD Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L_sgRNA1
Plasmid#201600PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L (LUC7L Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L_sgRNA2
Plasmid#201601PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L (LUC7L Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L2_sgRNA2
Plasmid#201603PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L2 (LUC7L2 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PABPC1_sgRNA2
Plasmid#201609PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPABPC1 (PABPC1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR PARL sg1
Plasmid#244853PurposeKnockout of human PARLDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR PARL sg2
Plasmid#244854PurposeKnockout of human PARLDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR ATP23 sg1
Plasmid#244847PurposeKnockout of human ATP23DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR ATP23 sg2
Plasmid#244848PurposeKnockout of human ATP23DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA1
Plasmid#201594PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertGPI (GPI Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA2
Plasmid#201591PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ENO1_sgRNA1
Plasmid#201592PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertENO1 (ENO1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ENO1_sgRNA2
Plasmid#201593PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertENO1 (ENO1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA2
Plasmid#201595PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertGPI (GPI Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L3_sgRNA1
Plasmid#201604PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L3 (LUC7L3 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L3_sgRNA2
Plasmid#201605PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L3 (LUC7L3 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
V2-MESA-35F-M-dCas9
Plasmid#84506PurposeMESA target chain with V2-MESA ectodomain, 35 extracellular linkers, a flag tag, M cleavage sequence, and dCas9-VP64DepositorInsertV2-MESA-35F-M-dCas9
UseLentiviralTagsFlagExpressionMammalianPromoterCMVAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR IMMP2L sg2
Plasmid#244852PurposeKnockout of human IMMP2LDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only