We narrowed to 3,248 results for: cat.3
-
Plasmid#131496PurposeEndogenous tagging of Shank2: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-IRES-Luciferase-WPRE-bGH-pA (JDW 1509)
Plasmid#242572PurposeGateway 3' entry clone containing an IRES LuciferaseDepositorInsertIRES-Luciferase-WPRE-bGH-pA
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mStayGold-WPRE (JDW 1384)
Plasmid#242550PurposeGateway middle entry clone containing H2B-mStayGold with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmStayGold (monomeric StayGold)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mBaoJin-WPRE (JDW 1383)
Plasmid#242549PurposeGateway middle entry clone containing H2B-mBaoJin with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmBaoJin
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2783 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-16 CMV-BFP
Plasmid#240513PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-16 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2784 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-20a CMV-BFP
Plasmid#240514PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-20 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2785 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-125a CMV-BFP
Plasmid#240515PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-125a Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2786 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-151a CMV-BFP
Plasmid#240516PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-151a Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS2787 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-221 CMV-BFP
Plasmid#240517PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-221 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS1354 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-1 CMV-BFP
Plasmid#226113PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-1-5p Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS1355 CMV-AcrIIC3-FLAGNLS-mCherry CMV-BFP
Plasmid#226114PurposeMammalian expression of AcrIIC3-mCherry fusion without microRNA target sites in the 3' UTR as a control reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEJS1352 CMV-AcrIIC3-FLAGNLS-mCherry-3xmiR-22 CMV-BFP
Plasmid#226111PurposeMammalian expression of AcrIIC3-mCherry fusion with microRNA target sites in the 3' UTR as a reporter of microRNA repression. BFP expressed separately as a transfection control.DepositorInsertAcrIIC3
TagsFLAG, hsa-miR-22 Target Sites, and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E-WPRE-bGH-pA (JDW 1221)
Plasmid#224527PurposeA Gateway compatible 3' entry clone containing a WPRE upstream of Bovine growth hormone polyA to stabilize mRNDepositorInsertWPRE-bGH
UseGateway cloningAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-H2A_mCherry_SV40pA (JDW 967)
Plasmid#224528PurposeA Gateway compatible 3' entry clone containing an H2A mCherry fusion followed by SV40 late polyADepositorInsertH2A-mCherry-SV40pA
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-IRES-H2A-mCherry-SV40-pA (JDW 1256)
Plasmid#224532PurposeA Gateway compatible 3' entry clone containing an IRES H2A mCherry followed by a polyADepositorInsertIRES-H2A-mCherry-SV40pA
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E EFS-rtTA/rtTA3 (JDW 1214)
Plasmid#224533PurposeA Gateway compatible 3' entry clone containing the Human EFS promoter driving rtTA-3rd generation transactivatorDepositorInsertrtTA
UseGateway cloningPromoterEFSAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-Actin-Vhh-mNeonGreen-HA (JDW 1225)
Plasmid#224534PurposeA Gateway compatible 3' entry clone containing an Actin nanobody fused to mNeonGreen with a c-terminal HA tagDepositorInsertActin-Vhh-mNeonGreen-HA
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-IRES-mTagBFP2-pA (JDW 1361)
Plasmid#224535PurposeA Gateway compatible 3' entry clone containing an IRES-FLAG-NLS-mTagBFP2-pADepositorInsertIRES-FLAG-NLS-mTagBFP2-pA
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only