We narrowed to 15,623 results for: grna
-
Plasmid#178746PurposeExpression of a gRNA that targets next to PAM library, used for A. chroococcum type I-E #3 systemDepositorInsertgRNA that targets next to PAM library, used for A. chroococcum type I-E #3 system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc2_gRNA1
Plasmid#178740PurposeExpression of a gRNA that targets next to PAM library, used for A. chroococcum type I-E #2 systemDepositorInsertgRNA that targets next to PAM library, used for A. chroococcum type I-E #2 system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003.gEZH2
Plasmid#220318PurposeExpresses guide RNA for CRISPR/Cas9 knockout of EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22D
Plasmid#91136PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23D
Plasmid#91141PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pV1093
Plasmid#111428PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJin-239
Plasmid#125716PurposeABA-inducible split T7 gRNA for GFP vector using RNAPN N-29-1DepositorInsertpT7-gRNA GFP expression, PYL-linker-T7 RNAPC, T7 RNAPN (N-29-1)-linker-ABI
ExpressionMammalianAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJH2971
Plasmid#100955PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. KANMX markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAW005-2
Plasmid#85611PurposeEmpty gRNA delivery vector for Bacillus subtilisDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3_nsgRNA(PP7)
Plasmid#232444PurposensgRNA for PE3 facilitation of a +1 T to A prime edit on the HEK3 locus, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3) for HEK3+1t>a edit driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHACK-GAL4>QF2
Plasmid#80275PurposeGAL4->QF2 HACK construct. Contains 5' and 3' GAL4 homology arms and gRNAs.DepositorInsertQF2
ExpressionInsectAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA_expression_vector
Plasmid#210212PurposeAn empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.DepositorTypeEmpty backboneExpressionBacterial and MammalianPromoterU6Available SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX330-PTEN
Plasmid#227440PurposeCas9 expression and a gRNA targeting Exon 6 of mouse PTENDepositorInsertspCas9 and gRNA for mouse PTEN (Pten )
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV1064
Plasmid#247972PurposeCRISPR-Cas9 vector containing two 20 nt protospacer sequences to target the gene wA in Aspergillus nidulans. pyrG markerDepositorInsertCas9-AMA1-wA-gRNA 1 & 2-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgNT-1-EF1a-LibVec
Plasmid#239592Purposeexpresses non-targeting (NT) guide#1DepositorInsertNT (non-targeting guide)
UseAAV; To deliver a non-targeting guide (serving as…PromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Frodo-eCMV-SaSpD10A (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210734PurposeCoding for SaSp D10A Cas9 alongside Frodo sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Frodo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only