We narrowed to 6,528 results for: human c myc
-
Plasmid#126705Purposedonor vector for targeting a 2A peptide followed by green fluorescent reporter to the human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertGFP
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
VEGFR2-YFP
Plasmid#108853PurposeEncodes for human VEGFR2 fluorescently labeled with eYFP on the C-Terminus via a 3 amino acid (GGS) flexible linkerDepositorInsertKDR (KDR Human)
UseTagsLabeled with eYFP on the C-Terminus via a 3 amino…ExpressionMammalianMutationPromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-RNMT 1-120
Plasmid#112706PurposeExpresses N-terminally FLAG-tagged human RNMT 1-120 in mammalian cellsDepositorInsertRNMT (RNMT Human)
UseTagsFLAGExpressionMammalianMutationdeleted amino acids 121-476PromoterCMVAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-RNMT 121-476
Plasmid#112707PurposeExpresses N-terminally FLAG-tagged human RNMT 121-476 in mammalian cellsDepositorInsertRNMT (RNMT Human)
UseTagsFLAGExpressionMammalianMutationdeleted amino acids 2-120PromoterCMVAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyTagsExpressionBacterial and YeastMutationPromoter2xLexop-minimalCyc1 and PACT1Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorInsertRAF1 (RAF1 Human)
UseTagsExpressionMammalianMutationWTPromoterAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSF-DUET-C17orf53_1-87-Strep
Plasmid#211433Purposebacterial expression of the N-terminal amino acids 1-87 of human C17orf53 C-terminally fused to a Strep-TagDepositorInsertC17orf53 (HROB Human)
UseTagsStrep-TagExpressionBacterialMutationDeletion of aa 88-646PromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p667-UBC-PKMYT1-V5_IDG-K
Plasmid#135248PurposeGateway destination clone of PKMYT1 (human) tagged with C-terminal V5 for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertPKMYT1-V5 (PKMYT1 Human)
UseLentiviral; Gateway destinationTagsV5ExpressionMammalianMutationPromoterUbiquitinAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
R777-E006 Hs.AKT3-nostop
Plasmid#70290PurposeGateway ORF clone of human AKT3 [NM_005465.4] without stop codon (for C-terminal fusions)DepositorInsertAKT 3 (AKT3 Human)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSF-DUET-C17orf53_1-241-Strep
Plasmid#211434Purposebacterial expression of the N-terminal amino acids 1-241 of human C17orf53 C-terminally fused to a Strep-TagDepositorInsertC17orf53 (HROB Human)
UseTagsStrep-TagExpressionBacterialMutationDeletion of aa 242-646PromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA6
Plasmid#101418PurposeDonor Vector containing GATA6 transcription factor, part of the Human TFome CollectionDepositorInsertGATA6 (GATA6 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-GATA4
Plasmid#101417PurposeDonor Vector containing GATA4 transcription factor, part of the Human TFome CollectionDepositorInsertGATA4 (GATA4 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXN1
Plasmid#101445PurposeDonor Vector containing FOXN1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXN1 (FOXN1 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF804B
Plasmid#88756PurposeDonor Vector containing ZNF804B transcription factor, part of the Human TFome CollectionDepositorInsertZNF804B (ZNF804B Human)
UseGateway donor vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXQ1
Plasmid#101628PurposeDonor Vector containing FOXQ1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXQ1 (FOXQ1 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HES3
Plasmid#101411PurposeDonor Vector containing HES3 transcription factor, part of the Human TFome CollectionDepositorInsertHES3 (HES3 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXI3
Plasmid#101518PurposeDonor Vector containing FOXI3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXI3 (FOXI3 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ASCL3
Plasmid#101515PurposeDonor Vector containing ASCL3 transcription factor, part of the Human TFome CollectionDepositorInsertASCL3 (ASCL3 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HOXB3
Plasmid#101478PurposeDonor Vector containing HOXB3 transcription factor, part of the Human TFome CollectionDepositorInsertHOXB3 (HOXB3 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXE3
Plasmid#101429PurposeDonor Vector containing FOXE3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXE3 (FOXE3 Human)
UseGateway shuttling vectorTagsExpressionMutationLast nucleotide of stop codon removed to allow fo…PromoterAvailable sinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only