We narrowed to 10,757 results for: ESP
-
Plasmid#12009DepositorInsertN15 3'UTR mut (FGFR1 Human)
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3XFLAG-MKK7-EE-NLS hygro
Plasmid#87780PurposeInducible expression of constitutively active mutant MKK7 with a C-terminal NLS sequenceDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCELF PAI-RBP v3
Plasmid#45507DepositorAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag MFF iso4 S172A
Plasmid#74393PurposeFlag tagged human S172A MFF isoform 4 mutantDepositorInsertFlag-MFF (MFF Human)
TagsFlagExpressionMammalianMutationSer 172 Ala (numbering based on MFF isoform 1)Available SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(84Q)-S776A
Plasmid#21758DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 84 Q(Glutamines) and…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST27-GST-ATXN1 FL(30Q)-S776A
Plasmid#21756DepositorInsertAtaxin-1 (ATXN1 Human)
TagsGSTExpressionMammalianMutationinsert contains a stretch of 32 amino acids (30 Q…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-His-GFP-RAD54L2
Plasmid#247924PurposeInsect expression construct for N-terminal His-GFP-tagged RAD54L2DepositorAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-CYP2A6(C14A, C439A)-flag-tev-halo-his
Plasmid#227162PurposeFor T-REX experiments of CYP2A6 C14A and C439A double mutant. Less sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 14 and cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-cyp-33e1(C295A, C439A)-flag-tev-halo-his
Plasmid#227158PurposeFor T-REX experiments of cyp-33e1 C295A and C439A double mutant. Almost no sensing ability to reactive electrophilic species (RES).DepositorInsertcyp-33e1 (cyp-33E1 Nematode)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 295 and cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-CYP2A6(C439A)-flag-tev-halo-his
Plasmid#227161PurposeFor T-REX experiments of CYP2A6 C439A mutant. Less sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-CYP2A6(C82A, C439A)-flag-tev-halo-his
Plasmid#227163PurposeFor T-REX experiments of CYP2A6 C82A and C439A double mutant. Almost no sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 82 and cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-LG4_chr5:550kb antisense
Plasmid#205468PurposeEnhancer containing plasmid used for assessing enhancer::promoter interactionsDepositorInsertchr5:550kb LG4
UseSynthetic Biology; Subcloning of taq-amplified pc…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ER-RE_MLPmin_BC1064-luc2
Plasmid#227110PurposeEstrogen receptor response element for luciferase and barcode assays; barcode BC1064DepositorInsert12x clustered ER response element linked to MLP minimal promoter driving barcode 1064 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF2479
Plasmid#142947PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-WIPI1promotor
Plasmid#206840PurposeThe plasmid contains the human WIPI1 promotor sequence (-1226 bp upstream to +329 bp downstream of the transcription start site) cloned into pGL4.23[luc2/minP] (NheI/HindIII).DepositorInsertWIPI1 promotor (partial)
UseLuciferaseAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A 2xHA GPR137
Plasmid#226809PurposeGateway entry vector for GPR137DepositorInsertGPR137 (GPR137 Human)
UseGateway entryTags2xHA tag followed by a GDPPVAT linkerMutationSequence optimized from NP_001164351Available SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GR-RE_MLPmin_BC1093-luc2
Plasmid#227113PurposeGlucocorticoid receptor response element for luciferase and barcode assays; barcode BC1093DepositorInsert12x clustered GR response element linked to MLP minimal promoter driving barcode 1093 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-Δhel1/Δhel2HRI-GFP-IRES-mCherry
Plasmid#226101PurposeHRI stability reporter construct with deletion of SIFI degron helices 1&2 for transient expression in mammalian cellsDepositorInsertHRI (EIF2AK1 Human)
TagsGFPExpressionMammalianMutationSIFI degron helices 1 & 2 deleted (Δ61-112)Available SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-N-HRI(1-138)-GFP-IRES-mCherry
Plasmid#226100PurposeHRI N-terminal region (residues 1-138) stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-EF1A-Puro-mCherry-RAB7-S72A
Plasmid#221556PurposeExpresses Cherry-tagged human Rab7 with S72A mutation in mammalian cells. Compatible with piggybac transposase for genome integration.DepositorInsertRab7A (RAB7A Human)
UsePiggybacTagsmCherryExpressionMammalianMutationChange serine 72 to alaninePromoterEF1aAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRHDGAL43C
Plasmid#218279PurposeIntroduction of a LowTempGAL Turbo module (HD-GAL43C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-PENO2> UBI4>RHGSGTMV>DHFRP66L>G*6>GAL3C(S509P)-tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P), DHFR (P66L)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRHDGAL3C
Plasmid#218276PurposeIntroduction of a LowTempGAL Turbo module (HD-GAL3C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pENO2> UBI4>RHGSGTMV>DHFRP66L>G*6>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P), DHFR (P66L)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBluescript II Ks(+)-ZsGreen1-SV40 PolyA-Stop Mettl3 HDR
Plasmid#207136PurposeDNA sequence source for amplifying an HDR template for mouse Mettl3 knockout and reporter knock-inDepositorInsert5'HDR Mettl3 - ZsGreen- sv40(polyA) - 3'HDR Mettl3 (Mettl3 Mouse)
ExpressionMammalianAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2trLATm2allL+A
Plasmid#203750PurposeEncodes the transmembrane domain from human LAT with mEos3.2 fused on the C terminus. Residues within the transmembrane domain mutated to L and A to increase the TMD interfacial surface area with the membrane. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiPOLR2D
Plasmid#202445PurposeExpression of a CRISPRi guide targeting POLR2DDepositorAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003-sgUBR4
Plasmid#202442PurposeExpression of a guide RNA targeting UBR4DepositorAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003-sgUBA6
Plasmid#202440PurposeExpression of a guide RNA targeting UBA6DepositorAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2478
Plasmid#142101PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-6xHis-TEV-Nsp8(76-198)
Plasmid#201024PurposeBacterial expression of codon optimized SARS-CoV-2 nsp8 residues 76-198, with an N-terminus His tag followed by a TEV cleavage site.DepositorInsertnon-structural protein 8 (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
Tags6xHis-TEVExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS_phleo-Tps1/Gsy2
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROS13-Tps2/Gsy1
Plasmid#196613PurposeEncoding guide RNAs for the knock out of TPS2 and GSY1 genesDepositorAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUGP1.1
Plasmid#196615PurposePlasmid used for the C-terminal tagging of Ugp1 with mCherry and the auxin-inducible degron in yeastDepositorInsertUGP1::mCherry-AID(71-114)-NatMX (UGP1 Budding Yeast)
TagsAID(71-114) and mCherryExpressionYeastPromoterNative promoterAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Hygro(+)_GRHL1-R9A-L3F6H
Plasmid#177767PurposeOverexpression of 3xFLAG-6xHis tagged human GRHL1 (R9A mutation)DepositorAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Hygro(+)_GRHL1-S95A-L3F6H
Plasmid#177768PurposeOverexpression of 3xFLAG-6xHis tagged human GRHL1 (S95A mutation)DepositorAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Hygro(+)_GRHL1-K116A-L3F6H
Plasmid#177769PurposeOverexpression of 3xFLAG-6xHis tagged human GRHL1 (K116A mutation)DepositorAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Hygro(+)_GRHL1-T139A-L3F6H
Plasmid#177770PurposeOverexpression of 3xFLAG-6xHis tagged human GRHL1 (T139A mutation)DepositorAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Hygro(+)_GRHL1-S374A-L3F6H
Plasmid#177772PurposeOverexpression of 3xFLAG-6xHis tagged human GRHL1 (S374A mutation)DepositorAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Hygro(+)_GRHL1-K592A-L3F6H
Plasmid#177773PurposeOverexpression of 3xFLAG-6xHis tagged human GRHL1 (K592A mutation)DepositorAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Gucy1b2-IRES-nlsCre-IRES-taulacZ-FNF TV
Plasmid#105196Purposetargeting vector to generate a Gucy1b2-IRES-nlsCre-IRES-taulacZ mouse strain.DepositorInsertGucy1b2-IRES-nlsCre-IRES-taulacZ-FNF (Gucy1b2 Mouse)
UseMouse TargetingAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-NQO1(Y128F)
Plasmid#177141PurposeBacterial vector for expression of an N-terminal GST fusion of NQO1(Y128F) with a TEV protease site located between the GST tag and NQO1(Y128F)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_A37C-A44C
Plasmid#162582PurposeExpresses norovirus GI.1 VP1 protein with mutations A37C-A44C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAlanine 37 changed to Cysteine and Alanine 44 cha…PromoterpolyhedringAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_Q141V-P221L
Plasmid#162584PurposeExpresses norovirus GI.1 VP1 protein with mutations Q141V-P221L in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlutamine 141 changed to Valine and Proline 221 c…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_L144C-P221C
Plasmid#162585PurposeExpresses norovirus GI.1 VP1 protein with mutations L144C-P221C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationLeucine 144 changed to Cysteine and Proline 221 c…PromoterpolyhderinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only