We narrowed to 3,270 results for: actin
-
Plasmid#239325PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNA stargeting ZCRB1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting ZCRB1 (ZCRB1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC10 (pAVA3318)
Plasmid#239295PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC10DepositorInsertU6-driven sgRNA targeting EXOSC10 (EXOSC10 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_C1D (pP18(T)_B9-AVA4070)
Plasmid#239296PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting C1DDepositorInsertU6-driven sgRNA targeting C1D (C1D Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC2 (pP18(T)_C3-AVA4067)
Plasmid#239301PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC2DepositorInsertU6-driven sgRNA targeting EXOSC2 (EXOSC2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC4 (pP18(T)_C11-AVA4065)
Plasmid#239302PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC4DepositorInsertU6-driven sgRNA targeting EXOSC4 (EXOSC4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
Plasmid#239303PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5DepositorInsertU6-driven sgRNA targeting EXOSC5 (EXOSC5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A mLIR
Plasmid#215506PurposeExpresses GFP tagged human ATG2A with the mutation in LC3 interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…Available SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free deadFPPS-NES
Plasmid#182492PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein deadFPPS-AcNES1 (GAL7 promoter). deadFPPS is ERG20(K197G-K254A), an inactive mutant of ERG20.DepositorInsertsFPPS
deadFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HNF1B-WT-Flag-UTR
Plasmid#183239PurposeExpression of FLAG tagged HNF1BDepositorAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-CIB1-mCerulean-Rab11
Plasmid#140574PurposeFor use in light-induced protein inactivation through the interaction with CRY2DepositorTagsmCeruleanExpressionMammalianPromoterCMV IE94Available SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMVtight-HNF1A-FLAG-Hygro
Plasmid#183232PurposeLentiviral vector; Tet-on advanced system driving the expression of tagged HNF1ADepositorAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-MPP8-10xHis
Plasmid#194178PurposeExpresses MPP8-10xHis taggedDepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
tetO-HEY2
Plasmid#170691Purposedoxycycline-inducible overexpression of HEY2DepositorInsertHEY2 – hes related family bHLH transcription factor with YRPW motif 2 (HEY2 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2-CIB1-mCherry-Rab11
Plasmid#140573PurposeFor use in light-induced protein inactivation through the interaction with CRY2DepositorTagsmCherryExpressionMammalianPromoterCMV IE94Available SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
p(HA)HIF1alpha(401delta603) (L795V, C800S, L818S, L822V)
Plasmid#52216Purposemammalian expression of HA tagged HIF1alpha with a deletion of the N-terminal activation domain and LCLL mutationDepositorInsertHIF1alpha (401delta603) LCLL (HIF1A Human)
TagsHAExpressionMammalianMutationaa 401-603 deleted, removes the oxygen-dependent …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCW57-mCherry-2A-BRD4 Iso AdelCTD
Plasmid#137722PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long isoform missing its C-terminal, P-TEFb interacting domain (CTD)DepositorInsertBRD4 long isoform without its C-terminal, P-TEFb interacting domain (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationTruncated at amino acid 1328PromoterTight TRE promoterAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-FLAG-MKK6
Plasmid#21582DepositorAvailable SinceNov. 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
CD8a-AA347-363- RVEP-4A-GFP
Plasmid#221597PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with RVEP4A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CD8a-AA347-363-KRN-3A-GFP
Plasmid#221598PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with KRN-3A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only