We narrowed to 1,212 results for: Ncl
-
Plasmid#120562PurposeExpresses HA-birA*-K-Ras G12D fusion protein in mammalian cells & for virus productionDepositorInsertKRAS4B (KRAS Human)
UseLentiviralTagsHA-birA*ExpressionMammalianMutationG12DPromoterCMVAvailable SinceMarch 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-RRBP1-WPRE-UbC-Emerald
Plasmid#225942PurposeLentiviral vector plasmid expressing human ribosome binding protein 1 (RRBP1) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC8B1
Plasmid#132198PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC8B1 (SLC8B1 Human)
ExpressionMammalianAvailable SinceOct. 28, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLEX-uORF-HA-birA*-H-Ras(G12V)-IRES-Puro
Plasmid#120560PurposeExpresses HA-birA*-H-Ras G12V mutant fusion protein in mammalian cells & for virus productionDepositorInsertHRAS (HRAS Human)
UseLentiviralTagsHA-birA*ExpressionMammalianMutationG12VPromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 C100A-WPRE-UbC-Emerald
Plasmid#225949PurposeLentiviral vector plasmid expressing human CKAP4 mutation C100A under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationC100APromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 CC-WPRE-UbC-Emerald
Plasmid#225950PurposeLentiviral vector plasmid expressing human CKAP4 mutation double cysteine (CC) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationAdditional cysteine inserted after Cys-100PromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(1-131)-WPRE-UbC-Emerald
Plasmid#225955PurposeLentiviral vector plasmid expressing human CKAP4 mutant lacking the luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationTruncated CKAP4 (1-131) lacking the luminal domainPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RTN4-WPRE-UbC-Emerald
Plasmid#225938PurposeLentiviral vector plasmid expressing human reticulon 4 (RTN4) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM2-WPRE-UbC-Emerald
Plasmid#225940PurposeLentiviral vector plasmid expressing human stromal interaction molecule 2 (STIM2) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GST-tev-hDNAJC5 L115R
Plasmid#246745PurposeBacterial expression of human DNAJC5 L115R with GST and a cleavage site for TEV protease on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsGSTExpressionBacterialMutationL115RPromoterlacZAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GST-tev-hDNAJC5 delL116
Plasmid#246744PurposeBacterial expression of human DNAJC5 L116 deleted with GST and a cleavage site for TEV protease on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsGSTExpressionBacterialMutationdelL116PromoterlacZAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MEK1C222
Plasmid#164638PurposeBacterial expression plasmid for His6-MEK1C222DepositorInsertmitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationG(-19)F/S222C/C277S/C376SPromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEM-GFP-URA3-GFP
Plasmid#72606PurposeTemplate for creating a C-terminal GFP tag AND an internal GFP tag from a single transfection of yeastDepositorInsertsGFP (full)
URA3
GFP (partial)
Optional Linker
MutationIncludes full 819 bp coding sequence of URA3, 435…Available SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hATG7CS
Plasmid#87868PurposeExpress a active-site mutant human Atg7/Apg7 C572S in mammalian cellsDepositorAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJV137
Plasmid#124256PurposeLentiviral vector (pRRL) containing Her2-ITD specific T cell receptorDepositorAvailable SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 S3E S17E S19E-WPRE-UbC-Emerald
Plasmid#225947PurposeLentiviral vector plasmid expressing human CKAP4 mutations S3E S17E S19E under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationS3E S17E S19EPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 S3A S17A S19A-WPRE-UbC-Emerald
Plasmid#225948PurposeLentiviral vector plasmid expressing human CKAP4 mutations S3A S17A S19A under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationS3A S17A S19APromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pJV132
Plasmid#124254PurposeLentiviral vector (pRRL) containing KRAS G12V specific T cell receptor, clone 3DepositorAvailable SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX-FKBP-Kras-Blasticidin
Plasmid#120714PurposeExpresses membrane-targeted recruiter protein in mammalian cells & for virus productionDepositorInsertKRAS4B (KRAS Human)
UseLentiviralTagsFKBP and mCherryExpressionMammalianMutationamino acids 158-188PromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
MEK1C218
Plasmid#164639PurposeBacterial expression plasmid for His6-MEK1C218DepositorInsertmitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationG(-19)F/S218C/C277S/C376SPromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(2xlumen)-WPRE-UbC-Emerald
Plasmid#225956PurposeLentiviral vector plasmid expressing human CKAP4 mutant with an additional luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationFull-length CKAP4 with additional luminal domain …PromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM1-WPRE-UbC-Emerald
Plasmid#225939PurposeLentiviral vector plasmid expressing human stromal interaction molecule 1 (STIM1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL1-WPRE-UbC-Emerald
Plasmid#225944PurposeLentiviral vector plasmid expressing human atlastin GTPase 1 (ATL1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC8B1_STOP
Plasmid#161364PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC8B1 (SLC8B1 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
MEK1C218C222
Plasmid#164640PurposeBacterial expression plasmid for His6-MEK1C218C222DepositorInsertmitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationG(-19)F/S218C/S222C/C277S/C376SPromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only