We narrowed to 14,985 results for: GRN
-
Plasmid#164040PurposeExpression of three sgRNAs (sgTS5, sgTS6, sgTS7) for targeting to CRISPR-Tag_V2DepositorInsertsgTS5-sgTS6-sgTS7
UseCRISPRPromotermouse U6Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
1782_pAAV-U6-Ai9-Sa-gRNA2-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135978PurposegRNA against the right loxP site of the Ai9 alleleDepositorInsertAi9 gRNA2
UseAAV, CRISPR, and Mouse TargetingTagsHAPromoterCBAvailable SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA1
Plasmid#117405PurposeSpyCas9 sgRNA 1 targeting TLR2.0DepositorInsertSpyCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd gRNA4 (FWA)
Plasmid#115486PurposeCRISPR-Cas9 SunTag system to target NtDRMcd to the FWA locus with a single guide RNADepositorInsertg4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-mCherry
Plasmid#240538PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with mCherry. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1a-LibVec
Plasmid#239591PurposeAAV vector for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ3538 eforRed-targeting sgRNA
Plasmid#239455Purposeguide for eforRedDepositorInsertguide targeting eforRed
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT4-U6-sgRNA-CMV-EGFP
Plasmid#239587PurposeSleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseSleeping beauty transposoneExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pM148: pAAV.CMV-Cas13e-NT sgRNA
Plasmid#203446PurposePlasmid expressing active RfxCas13d with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro hGSDME gRNA2
Plasmid#223520PurposeKnocking out hGSDME in human cellsDepositorAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA LINE1
Plasmid#223699PurposegRNA of dPspCas13b-FTO targeting LINE1DepositorInsertgRNA target sequence for LINE1
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDKN1A (p21) targeting gRNA
Plasmid#215319PurposeExpresses gRNA targeting CDKN1A (p21) and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-5)-PGKpuroBFP-W
Plasmid#211987PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro G3BP1-sgRNA
Plasmid#196197PurposeCas9 + gRNA expression to edit G3BP1 locusDepositorInsertG3BP1 (G3BP1 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-RPB1-N-term
Plasmid#195112PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-RPB1-N-term
Plasmid#195110PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-2-RPB1-C-term
Plasmid#195109PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 C-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against last exon of RPB1 (C-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only