We narrowed to 11,719 results for: ARIA;
-
Plasmid#233027PurposeTo Express HA tagged DjCas13d and mcherry from the mammalian EFS promoter. The DjCas13dx and mCherry are separated by a P2A siteDepositorInsertDjCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-P2A-mCherry-pA
Plasmid#233026PurposeTo Express HA Tagged hfCas13d and mcherry from the mammalian EFS promoter. The hfCas13d and mCherry are separated by a P2A siteDepositorInserthfCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro -GFP-delta73-82 REX1-IRES-mCherry
Plasmid#232246PurposeMammalian expression of delta73-82 REX1-GFP-IRES-mCherryDepositorInsertdelta73-82 REX1-GFP-IRES-mCherry (Zfp42 Mouse)
TagsAcGFP1ExpressionMammalianMutationdelta73-82Available SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro -GFP-I77P I78P REX1-IRES-mCherry
Plasmid#232245PurposeMammalian expression of I77P I78P REX1-GFP-IRES-mCherryDepositorInsertI77P I78P REX1-GFP-IRES-mCherry (Zfp42 Mouse)
TagsAcGFP1ExpressionMammalianMutationI77P I78PAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-parkin K161N
Plasmid#227365PurposeFor bacterial expression of parkin with a mutated pUbl/pUb binding site on RING0.DepositorInsertParkin K161N (PRKN Human)
TagsGSTExpressionBacterialMutationCodon usage optimized for E.coli expression. Chan…Available SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-parkin delta 101-109
Plasmid#227364PurposeFor bacterial expression of parkin with a mutated ACT.DepositorInsertParkin delta 101-109 (PRKN Human)
TagsGSTExpressionBacterialMutationCodon usage optimized for E.coli expression. Resi…Available SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP6
Plasmid#218245Purpose1) Ectopic expression of MAAP6 protein in mammalian cells. 2) Packaging MAAP6 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 6 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP9
Plasmid#218246Purpose1) Ectopic expression of MAAP9 protein in mammalian cells. 2) Packaging MAAP9 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIOS1458
Plasmid#171715Purposeexpresses maize Glutamine Synthetase ZmGln1-3 cDNA under the control of the Cassava Vein Mosaic Virus promoter (CsVMV) (cassette 1) and the maize Rubisco small subunit promoter (ZmRbcS) (cassette 2)DepositorInsertZmGln1-3
ExpressionPlantAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_K5Q-GS3
Plasmid#204746PurposeExpression of Cas9 and human H2AX with the K5Q mutationDepositorAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_K5R-GS3
Plasmid#204747PurposeExpression of Cas9 and human H2AX with the K5R mutationDepositorAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_K134L-GS3
Plasmid#204750PurposeExpression of Cas9 and human H2AX with the K134L mutationDepositorAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_K134M-GS3
Plasmid#204751PurposeExpression of Cas9 and human H2AX with the K134M mutationDepositorAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_K134A-GS3
Plasmid#204752PurposeExpression of Cas9 and human H2AX with the K134A mutationDepositorAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-hcr3
Plasmid#193660PurposeExpression of tandem pre-sgRNA array hcr3 for LbCas12aDepositorInsertU6-CFTR-sgRNA-KLF4-sgRNA-TET1-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-hcr5
Plasmid#193661PurposeExpression of tandem pre-sgRNA array hcr5 for LbCas12aDepositorInsertU6-DNMT3B-sgRNA-KLF4-sgRNA-TET1-sgRNA-PRR5L-sgRNA-CFTR-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-pcr4
Plasmid#193662PurposeExpression of tandem pre-sgRNA array pcr4 for LbCas12aDepositorInsertU6-PUM1-sgRNA-GHR-sgRNA-HMGA2-sgRNA-PUM2-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas12a-AID
Plasmid#193647PurposeExpression of base editor dCas12a-AID in mammalian cells for base editing, along with non-fused EGFP fluorescenceDepositorInsertdLbCas12a-hAID, EGFP
ExpressionMammalianPromoterCMVAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas12a-BE
Plasmid#193648PurposeExpression of base editor dCas12a-BE in mammalian cells for base editing, along with non-fused EGFP fluorescenceDepositorInsertdLbCas12a-rAPOBEC1, EGFP
ExpressionMammalianPromoterCMVAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas12a-CDA1
Plasmid#193649PurposeExpression of base editor dCas12a-CDA1 in mammalian cells for base editing, along with non-fused EGFP fluorescenceDepositorInsertdLbCas12a-PmCDA1, EGFP
ExpressionMammalianPromoterCMVAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas12a-eAID
Plasmid#193650PurposeExpression of base editor dCas12a-eAID in mammalian cells for base editing, along with non-fused EGFP fluorescenceDepositorInsertdLbCas12a-eAID, EGFP
ExpressionMammalianPromoterCMVAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP4-Δ220-234-Flag
Plasmid#210341PurposeExpresses SARS-CoV-2 NSP4-Δ220-234 fused with Flag in mammalian cellsDepositorInsertSARS-CoV-2 NSP4 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1, Human)
TagsFlagExpressionMammalianMutationΔ220-234Available SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP4-H120N/F121L-Flag
Plasmid#210340PurposeExpresses SARS-CoV-2 NSP4-H120N/F121L fused with Flag in mammalian cellsDepositorInsertSARS-CoV-2 NSP4 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1, Human)
TagsFlagExpressionMammalianMutationH120N/F121LAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP4-FR-2Strep
Plasmid#210316PurposeExpresses SARS-CoV-2 NSP4 in mammalian cellsDepositorInsertSARS-CoV-2 NSP4 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1, Human)
Tags2StrepExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP4-mCherry
Plasmid#210319PurposeExpresses SARS-CoV-2 NSP4 fused with mCherry in mammalian cellsDepositorInsertSARS-CoV-2 NSP4 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1, Human)
TagsmCherryExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
FKBP10-2Strep
Plasmid#210357PurposeExpresses FKBP10 fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
DNAJC11-2Strep
Plasmid#210354PurposeExpresses DNAJC11 fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETDUET-GST AO7RE ∆238-245
Plasmid#139318PurposeGST tagged AO7 encoding aa 126-258 with an internal deletion that results in loss of E2 binding for expression in bacteriaDepositorInsertAO7 aa 126-258 (RNF25 Human)
TagsGSTExpressionBacterialMutationAO7 cloned into the first multiple cloning site o…PromoterT7 promoter-1Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNK005C_BattB_mkozak_STIM1_IRES_mCherry-H2A-P2A-PuroR
Plasmid#200639PurposeLow STIM1 abundance recombination plasmid for Matreyek Bxb1(GT) landing pad in dual landing pad cellsDepositorInsertSTIM1 (STIM1 Human)
ExpressionMammalianAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:LYK5_At-3xHA
Plasmid#202192PurposeExpress Arabidopsis thaliana LYK5 gene under UBQ10 promoterDepositorInsertLYSM-CONTAINING RECEPTOR-LIKE KINASE 5 (LYK5 Mustard Weed)
TagsHAExpressionPlantPromoterAtUBQ10Available SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#1
Plasmid#197421PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #1 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#2
Plasmid#197422PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #2 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#3
Plasmid#197423PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #3 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#1
Plasmid#197424Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #1 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2
Plasmid#197425Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #2 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-In18runon-PTPN22
Plasmid#195377PurposeA human PTPN22 mutant (intron 18-runon) in Gateway pDONR221DepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-In18runon-PTPN22
Plasmid#195379PurposeMammalian expression of a human PTPN22 mutant (intron 18-runon) with FLAG tagDepositorAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-PTPN22
Plasmid#195375PurposeMammalian expression of a human PTPN22 mutant (exon 1-17) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-γ1
Plasmid#197078PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 γ1 fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-1 γ1 (Ap1g1 Mouse)
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Cue1pTM-MYC-UBE2G2
Plasmid#185346PurposeMembrane anchoring of UBE2G2. Encodes transmembrane domain of S. Cerevisiae Cue1p fused to MYC-UBE2G2DepositorInsertCue1p/Ube2G2 fusion (internal MYC tag)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Cue1pTM-MYC-UBE2G2-FLAG
Plasmid#185347PurposeMembrane anchoring of UBE2G2 and co-IP. Encodes transmembrane domain of S. Cerevisiae Cue1p fused to MYC-UBE2G2 with C-terminal FLAG tagDepositorInsertCue1p/Ube2G2 fusion (internal MYC tag)
TagsFLAGExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-AVPR2-NTEV-TCS-GV-2xHA
Plasmid#194371PurposeSplit TEV assaysDepositorInsertSP-AVPR2-NTEV-TCS-GV-2xHA (AVPR2 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-GLP1R-NTEV-TCS-GV-2xHA
Plasmid#194379PurposeSplit TEV assaysDepositorInsertSP-GLP1R-NTEV-TCS-GV-2xHA (GLP1R Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-DRD1-NTEV-TCS-GV-2xHA
Plasmid#194359PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD1-V2R-NTEV-TCS-GV-2xHA
Plasmid#194360PurposeSplit TEV assaysDepositorInsertDRD1-V2R-NTEV-TCS-GV-2xHA (DRD1 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD2-NTEV-TCS-GV-2xHA
Plasmid#194362PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only