We narrowed to 27,672 results for: STI;
-
Plasmid#165432PurposeExpresses tdTomato and photoactivatable CaMKII(T286A: Autophosphorylation deficient) in mammalian cells to induce synaptic plasticity.DepositorInserttdTomato-P2A-paCaMKII(T286A)
TagstdTomatoExpressionMammalianMutationT286A: Autophosphorylation deficient mutationPromoterCMVAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgGFP-1
Plasmid#74960PurposeCas9 + sgGFP-1 with blasticidin selectionDepositorInsertGFP
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR3.1 GSK3beta S9A HA
Plasmid#15994DepositorAvailable SinceOct. 26, 2007AvailabilityAcademic Institutions and Nonprofits only -
pFA-DAB2
Plasmid#162690PurposeExpresses DabAB2 inorganic carbon transport complexDepositorInsertDabAB2 inorganic carbon transport complex
ExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSP2262
Plasmid#70703PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 1: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A & H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
rat Kv3.1-HA
Plasmid#113055PurposeExpresses rat Kv3.1 in mammalian cellsDepositorAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-83:EZH2-mEGFP
Plasmid#164499PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human EZH2DepositorInsertEZH2 Homology Arms with mEGFP-linker (EZH2 Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceFeb. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEPQD2KN0908
Plasmid#177088PurposeMoClo Level 2 plasmid containing multiple transcriptional units for transient expression of P19 (cytosol, driven by nosP), along with CrDXS2, PaGPPS1, and CrGES (plastid, driven by 4x opaatB)DepositorInsertP19, CrDXS2, PaGPPS1, and CrGES
UseSynthetic BiologyAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
L2-AA007
Plasmid#185750PurposeVector to introduce HygR and eGFP under control of p35S into the genome of the hornwort Anthoceros agrestis via Agrobacterium mediated transformation. eGFP contains a cell membrane localization tag.DepositorInsertsHygR2
eGFP
Tagsmembrane localization tag Lti6bExpressionPlantAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
bPAC-mycHis_pGEM
Plasmid#85468PurposeExpression of photoactivated cyclase bPAC of Beggiatoa sp.DepositorInsertBacterial Photoactivated Adenylyl Cyclase
TagsHis and MycPromoterT7 promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIND-CLucZ
Plasmid#53224PurposeInducible expression of Cypridina luciferase and shRNAmir of interestDepositorInsertsCypridina luciferase
non-silencing shRNA
UseLentiviralExpressionMammalianAvailable SinceJune 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA4/TO h-PKD1 FLS (4107-4303)-GST
Plasmid#83456PurposeHuman PC1-CTp30 expression cassette with a GST-tag (678)DepositorAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP2279
Plasmid#70706PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 2: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A and H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS SK mCherryROSAbsr
Plasmid#54321PurposeEncodes mCherry fused with out-of-frame blasticidin-S resistance gene with a linker containing a target for TALEN/CRISPR. Can use as a surrogate target to select cells expressing active TALEN/CRISPR.DepositorInsertmCherry and BlasticidinS-resistance
UseCRISPR, Mouse Targeting, and TALENExpressionMammalianPromoterCMVAvailable SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T merlin 1-332
Plasmid#11631DepositorAvailable SinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BD-cop1at(335-675)
Plasmid#44973DepositorInsertBD-COP1 (COP1 Mustard Weed)
TagsGAL4 DNA-binding domainExpressionMammalianMutationdeleted amino acids 1-334PromoterpCMVAvailable SinceJune 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
MTK0_047
Plasmid#123977PurposeEncodes the Cas9 hCLYBL homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInserthCLYBL CAS9 Destination - HygroR
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only