We narrowed to 4,378 results for: crispr c plasmids
-
Plasmid#204673PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pAAV_Donor/Reporter-COL4A3
Plasmid#130279PurposeCOL4A3 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A3 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_Helper
Plasmid#190432PurposeM13 helper genes cloned into the pSEVA631 vector. This plasmid does not carry an M13 packaging signal. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ297.)DepositorInsertM13 genes: I-XI
UseSynthetic BiologyAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVDnmt3A_bGHpA
Plasmid#177349PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVtet2_bGHpA
Plasmid#177353PurposeAAV expression of scFV-fused catalytic domain of TET2 from Synapisin promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…Promoterhuman Synapsine promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKT07_AAV-hU6-AsDR-crTSG1-EFS-Cre-T2A-hNGFR
Plasmid#256630PurposeAAV vector for delivery of AsCas12a crTSG1 guide array and expressing Cre using EFS promoterDepositorInsertcrTrp53, crPten, crApc, crRb1
UseAAVPromoterhumanU6, EFS-NSAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKT07_AAV-hU6-AsDR-EFS-Cre-T2A-hNGFR
Plasmid#256629PurposeAAV vector for delivery of AsCas12a guides and expressing Cre and hNGFR using EFS promoterDepositorTypeEmpty backboneUseAAVAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGW004_pAAV-hU6-SapI-hTBG-Fluc-P2A-Cre
Plasmid#256631PurposeAAV vector for delivery of Cas9 guide and expressing Fluc and Cre using hTBG promoterDepositorTypeEmpty backboneUseAAVAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3A_bGHpA
Plasmid#177355PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVtet1_bGHpA
Plasmid#177357PurposeAAV expression of scFV-fused catalytic domain of TET1 from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationN terminal domain of human Tet1PromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVtet2_bGHpA
Plasmid#177358PurposeAAV expression of scFV-fused catalytic domain of TET2 from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…PromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSEVA63_HelperΔgIII
Plasmid#190433PurposeM13 helper genes cloned into the pSEVA631 vector, except the minor coat protein coding gene gIII (also called gp3, or g3p). This plasmid does not carry an M13 packaging signal.DepositorInsertM13 genes I-V and VII-XI
UseSynthetic BiologyAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQnl_Pcphy23
Plasmid#191354PurposeClostridium plasmid expressing NanoLuc reporter from moderate, constitutive promoterDepositorInsertPcphy23-NanoLuc
ExpressionBacterialPromoterPcphy23Available SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUt-mPF-BACH1 Cas9-Resistant_AmpR
Plasmid#199221PurposeLPUtopia-7 matching RMCE donor plasmid with Cas9-resistant GFP-BACH1 Positive-Feedback circuit (mPF-BACH1). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertrtTA-Advanced::P2A::EGFP::BACH1 (BACH1 Human)
TagsEGFPExpressionMammalianMutationsilient mutation at nucleic acid 177 C changed to…Promotertight TRE promoterAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP947
Plasmid#239869PurposeWild type TCTP promoter driving the expression of Renilla luciferaseDepositorInsertTCTP::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1022
Plasmid#239944PurposeFirefly luciferase plus as a Level-0 part (Golden Gate)DepositorInsertFluc
UseSynthetic BiologyTagsPEST on C-terminus of Fluc plusMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1021
Plasmid#239943PurposeRenilla luciferase as a Level-0 part (Golden Gate)DepositorInsertRluc
UseSynthetic BiologyMutationN/AAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP979
Plasmid#239901PurposeCaMV 35S-SynPro-14 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-14::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP955
Plasmid#239877PurposeTCTP-SynPro-08 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-08::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP956
Plasmid#239878PurposeTCTP-SynPro-09 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-09::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP957
Plasmid#239879PurposeTCTP-SynPro-10 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-10::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP958
Plasmid#239880PurposeTCTP-SynPro-11 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-11::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP953
Plasmid#239875PurposeTCTP-SynPro-06 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-06::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP954
Plasmid#239876PurposeTCTP-SynPro-07 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-07::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only