We narrowed to 5,715 results for: Feng Zhang
-
Plasmid#196711PurposeCRISPR-activation. dCas9-VP64 with TagBFP for sortingDepositorInsertdCas9-VP64-T2A-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSMutationD10A, N863APromoterEF1aAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-UCOE-dCas9-BFP-VP64
Plasmid#196717PurposeCRISPR-activation. dCas9-VP64 with TagBFP for sorting.DepositorInsertdCas9-TagBFP-VP64
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSMutationD10A, N863APromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-CBA-dt/PGK-CFTR-⌀
Plasmid#163923PurposeExpresses human CFTR.DepositorAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF6-CSPG4-myc-his
Plasmid#69037PurposeExpression of CSPG4 in mammalian cellsDepositorAvailable SinceSept. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-GFAP-NLS-CasRx-NLS-FLAG
Plasmid#154000PurposeExpress CasRx for AAV packageDepositorInsertCasRx
UseAAV and CRISPRTagsFLAGPromoterGFAPAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G88P3-HA-hM3Dq
Plasmid#213972PurposeAAV vector with G88P3 promoter that can drive robust gene expression in MSNsDepositorInserthM3D (Gq)
UseAAVPromoterG88P3Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PrP (1-22)-BioID2-HA-13 x Linker- RBP(Z)-GPI-PSS
Plasmid#194755PurposeLentiviral expression of BioID2-HA-13 x Linker- RBP(Z) on the cell surface via a GPI anchorDepositorInsertPrP (1-22)-BioID2-HA-13 x Linker- RBP(Z)-GPI-PSS
UseLentiviralTagsHAPromoterCMVAvailable SinceApril 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 7 deletion
Plasmid#224388PurposeLenti plasmid for generating GNB1L _WD 7 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianMutationWD 7 domain deleted (aa 286-323)Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 6 deletion
Plasmid#224387PurposeLenti plasmid for generating GNB1L _WD 6 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianMutationWD 6 domain deleted (aa 242-282)Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 4 deletion
Plasmid#224385PurposeLenti plasmid for generating GNB1L _WD 4 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianMutationWD 4 domain deleted (aa 153-195)Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_GNB1L_gRNA
Plasmid#224377PurposeTargets GNB1L for dTAG C terminal knock-in cell linesDepositorAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PrP (1-22)-BioID2-HA-13 x Linker- RBP(V)-GPI-PSS
Plasmid#194753PurposeLentiviral expression of BioID2-HA-13 x Linker- RBP(V) on the cell surface via a GPI anchorDepositorInsertPrP (1-22)-BioID2-HA-13 x Linker- RBP(V)-GPI-PSS
UseLentiviralTagsHAPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PrP (1-22)-RBP(V)-13 x Linker-BioID2-HA-GPI-PSS
Plasmid#194752PurposeLentiviral expression of RBP(V)-13 x Linker-BioID2-HA on the cell surface via a GPI anchorDepositorInsertPrP (1-22)-RBP(V)-13 x Linker-BioID2-HA-GPI-PSS
UseLentiviralTagsHAPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgCTL
Plasmid#234771PurposeNon Targeting ControlDepositorInsertNon Targeting Control sgRNA
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cas12Max
Plasmid#195334Purposevector for encoding a human codon-optimized Cas12Max driven by CBh promoter, guide RNAs compatible with xCas12i driven by hU6, and mCherry driven by CMV promoterDepositorInserthuman codon-optimized Cas12Max
Tags3xFlagExpressionMammalianMutationN243RPromoterCBh, CMV, hU6Available SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
xCas12i
Plasmid#195333Purposevector for encoding a human codon-optimized xCas12i driven by CBh promoter, guide RNAs compatible with xCas12i driven by hU6, and mCherry driven by CMV promoterDepositorInserthuman codon-optimized xCas12i
Tags3xFlagExpressionMammalianPromoterCBh, CMV, hU6Available SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
DHFR-SpCas9-DHFR
Plasmid#85447PurposeExpresses SpCas9 fused to DHFR domain on both N- and C-termini in mammalian cellsDepositorInsertDHFR-SpCas9-DHFR
UseAAVTagsDestabilized domain (C-terminus version) of E.col…ExpressionMammalianPromoterCbhAvailable SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
LentiCRISPRv2-mCherry
Plasmid#99154PurposeLentiviral vector encoding sgRNA cloning site + hSpCAS9-P2A-mCherry.DepositorInsertsCas9
mCherry
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NSAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR.v2.TetON_Cas13d_U6_DR
Plasmid#196727PurposeSortable and selectable, Tet-inducible RfxCas13d with guide cassette (one vector system). Inducible knock-down.DepositorInsertRfxCas13d-T2A-miRFP670nano
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterTREAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-KRAB-MECP2-H2B-mCherry (CRISPRi)
Plasmid#175574PurposeInactivated Cas9 (dCas9) fusion to KRAB and MeCP2 for the purpose of targeted repressionDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-dCas9-KRAB-MECP2-H2B-GFP (CRISPRi)
Plasmid#175573PurposeInactivated Cas9 (dCas9) fusion to KRAB and MeCP2 for the purpose of targeted repressionDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC7A11/xCT-1
Plasmid#161818Purposeknock out SLC7A11/xCT in mammalian cellsDepositorInsertSLC7A11 solute carrier family 7 member 11 xCT (SLC7A11 Human)
UseCRISPR and LentiviralAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSLC7A11/xCT-2
Plasmid#161819Purposeknock out SLC7A11/xCT in mammalian cellsDepositorInsertsolute carrier family 7 member 11 (SLC7A11 Human)
UseCRISPR and LentiviralAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgPnpt1-2#
Plasmid#234770Purposeknockout Pnpt1DepositorInsertPnpt1 (Pnpt1 )
UseLentiviralAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgPnpt1-1#
Plasmid#234769Purposeknockout Pnpt1DepositorInsertPnpt1 (Pnpt1 )
UseLentiviralAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgPlscr3-2#
Plasmid#234772Purposeknockout Plscr3DepositorInsertPlscr3 (Plscr3 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgPlscr3-1#
Plasmid#234767Purposeknockout Plscr3DepositorInsertPlscr3 (Plscr3 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only