We narrowed to 4,638 results for: crispr c plasmids
-
Plasmid#139452PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A5
Plasmid#130280PurposeCOL4A5 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A5 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-CRY2PHR-SID4X
Plasmid#63663PurposeAAV expression of CRYS2PHR-SID4XDepositorInsertSID4X-CYR2PHR
UseAAVExpressionMammalianPromoterEF1alphaAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1a-LibVec
Plasmid#239591PurposeAAV vector for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN-U6-Camk2d sgRNA7
Plasmid#226678PurposeExpresses TadA8e and Sauri cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSauri Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-TadA8e-SpRY N aa2-713-InteinN
Plasmid#209786PurposeExpresses TadA8e and SpRY cas9N by the specific TNT4 promoterDepositorInsertTNT4, TadA8e, SpRY N, inteinN
UseAAVPromoterTNT4Available SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_1
Plasmid#204672PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_2
Plasmid#204673PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A3
Plasmid#130279PurposeCOL4A3 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A3 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g3 (BB36)
Plasmid#139454PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g2 (BB35)
Plasmid#139453PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-CD16-TLR4-HA
Plasmid#246906PurposeExpresses CD16-TLR4 chimera in mammalian cellsDepositorUseLentiviralTagsHAExpressionMammalianMutationN terminus of CD16, C terminus of TLR4PromoterCMVAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(FCA)-6xHis-NLS(SV40)
Plasmid#185701PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(FCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(FCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-6xHis-NLS(SV40)
Plasmid#185703PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(SCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-6xHis-NLS(SV40)
Plasmid#185704PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(BCA)-6xHis-NLS(SV40)
Plasmid#185702PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(BCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(BCA)
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
JI501: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 gRNA scaffold
Plasmid#121841PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven SaCas9 gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KK701: pMAGIC (L3-L2) 3x HA eptitope tag + polyA; hU6::xCas9(3.7) gRNA scaffold
Plasmid#121842PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven xCas9(3.7) gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cas9_ANKRD1_sgRNA2
Plasmid#186669PurposePlasmid containing Cas9 and ANKRD1 sgRNA2 , sgRNA sequence: cggtcagcttatatagct.DepositorInsertANKRD1 KO sgRNA Plasmid (ANKRD1 Human)
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB101: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#2 gRNA
Plasmid#131758PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-hGeminin
Plasmid#199344Purposemodified version of the eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA plasmid (addgene #86613) where the C-terminus of the eSpCas9 enzyme was fused to amino acids 1 – 110 of human GemininDepositorInsertATP1A1 G3 sgRNA+user-specified sgRNA+enhanced specificity Cas9 (1.1) (addgene 86613) with cas9 fused to hgem fragment 1-110) (GMNN S. pyogenes)
Tagscas9 c-term fused to hgemenin 1-110 fragmentExpressionMammalianMutationcas9 c-term fused to hgemenin 1-110 fragmentPromotercbhAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only