We narrowed to 7,614 results for: Trac
-
Plasmid#178225PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.Ollas_mCherry-NLS
Plasmid#178223PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.V5_mCherry-NLS
Plasmid#178221PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.Ollas_mCherry-NLS
Plasmid#178218PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.Ollas_mCherry-NLS
Plasmid#178212PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMMP-NGFR:LMP1-IRES-mRFP
Plasmid#36974DepositorUseRetroviralExpressionMammalianMutationNGFR:LMP1 chimeric receptor consists of aa 1–276 …PromoterCMVAvailable SinceAug. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.S_mCherry-NLS
Plasmid#178276PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.Ollas_mCherry-NLS
Plasmid#178259PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.NWS_mCherry-NLS
Plasmid#178258PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-PTBP1-RRM12CCtoSS
Plasmid#89155PurposeRecombinant expression of PTBP1-RRM12 C250S,C251S in E.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 1+2 mutant C250S, C251S (PTBP1 Human)
Tagshexa HisExpressionBacterialMutationmutations: Cys 250 to Ser, Cys 251 to SerPromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-PLXNB2-decto
Plasmid#86238PurposeLentivirus for expression of human Plexin-B2 with deletion of ectodomainDepositorInsertPlexin-B2 (PLXNB2 Human)
UseLentiviralExpressionMammalianMutationPLXNB2 with deletion of extracellular domainPromoterhPGKAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/SH/GW-Mst2
Plasmid#84300PurposeExpresses a tetracycline-inducible SH-tagged (streptavidin-binding peptide and HA tag) version of Mst2. Used in conjunction with Flp-In cells to generate single copy transgene.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO NET1A-V5 WT
Plasmid#69828PurposeExpresses NET1A-V5 in mammalian cells in a doxycycline inducible mannerDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
UseLentiviralTagsv5ExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pScalps_puro_mIL-2Rα RK
Plasmid#59920PurposeExpresses mouse interleukin-2 receptor alpha chain mutatedDepositorInsertinterleukin 2 receptor alpha (Il2ra Mouse)
UseLentiviralMutationchanged sequence of the intracellular (C-terminal…Available SinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMTgR2
Plasmid#107286PurposePlasmid can be used for Drosophila S2 driven secretion of extracellular part of human interferon-_ receptor 2.DepositorInsertInterferon gamma receptor 2 (IFNGR2 Human)
TagsCATCATCACCATCACCATGAExpressionInsectPromoterMetallothionein promoterAvailable SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
TagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTYB3-human PUM1-HD PUF531_Q867E-Q939E-C935S-Q1011E- C1007S-intein-CBD
Plasmid#73306PurposeExpresses mutant human PUM1-HDDepositorInserthuman PUM1 Pumilio homology domain (PUM1 Human)
TagsinteinExpressionBacterialMutationQ867E-Q939E-C935S-Q1011E-C1007SAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
integrin alpha9 W999A pcDNA1 neo
Plasmid#13589DepositorAvailable SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pYTRW27K_7Ti1
Plasmid#177294Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and LacZDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-Ef1a-SOX17WT-3xFLAG
Plasmid#216198PurposeOverexpress wild-type human SOX17 in HEK 293T cells for use in whole cell extract EMSAsDepositorInsertSOX17 (SOX17 Human)
UseLentiviralMutationGlu113Glu (silent mutation); Glu120Glu (silent mu…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-Ef1a-SOX17E57D-3xFLAG
Plasmid#216199PurposeOverexpress human SOX17E57D in HEK 293T cells for use in whole cell extract EMSAsDepositorInsertSOX17 (SOX17 Human)
UseLentiviralMutationGlu113Glu (silent mutation); Glu120Glu (silent mu…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-Ef1a-SOX17E57P-3xFLAG
Plasmid#216200PurposeOverexpress human SOX17E57P in HEK 293T cells for use in whole cell extract EMSAsDepositorInsertSOX17 (SOX17 Human)
UseLentiviralMutationGlu113Glu (silent mutation); Glu120Glu (silent mu…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-TRE>hHES3:T2A:EGFP
Plasmid#236630PurposeHygromycin selected lentiviral construct with tetracyclin-inducible human HES3DepositorInsertsUseLentiviralExpressionMammalianMutationCodon optimized based on a variant of wildtype GF…PromoterTREAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pscAAV.T7-SP6-BC(p11-14)-CAG-EGFP-SV40pA-T7
Plasmid#231350PurposeSelf complementary AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-mDLX-minBG-CI-mRuby2-W3SL-T7
Plasmid#231352PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter with mDLX enhancer.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-minBG-CI-mRuby2-W3SL-T7
Plasmid#231353PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-tdTomato-W3SL-T7
Plasmid#231356PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses tdTomato from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CMVp-CI-mRuby2-W3SL-T7
Plasmid#231357PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from CMV promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-Ef1s-CI-mRuby2-W3SL-T7
Plasmid#231358PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from Ef1s promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-CI-mRuby2-W3SL-T7
Plasmid#231359PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CAG-EGFP-W3SL-T7
Plasmid#231348PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SS-Myc-HexaPro-Foldon (MTK 3a) (pZYW077)
Plasmid#194233PurposeMammalian Toolkit part 3a encoding Jason McClellan lab's 6-proline Spike extracellular domainDepositorInsertCD8a Signal Sequence-Myc Tag-SARS-CoV-2 Spike1-1258 (S Synthetic)
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Halo-tagged Sox17FNV
Plasmid#206391PurposeExpresses Halo-tagged mouse SOX17FNV in mammalian cells, for single-molecule tracking.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-GST-BTLAicd (AA190-289, Y257F, Y282F)-TwinStrep
Plasmid#180811PurposeExpression of GST fused human BTLA intracellular domain (AA190-289, Y257F, Y282F)-TwinStrepDepositorInsertGST-BTLAint (AA190-289, Y257F, Y282F)-TwinStrep (BTLA Human)
ExpressionBacterialMutationBTLA (Y257F, Y282F)PromoterT7Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.S.V5_mCherry-NLS
Plasmid#178281PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.S.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.Ollas.V5_mCherry-NLS
Plasmid#178280PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.Ollas.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.V5_mCherry-NLS
Plasmid#178275PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.VSVg_mCherry-NLS
Plasmid#178274PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.Ollas_mCherry-NLS
Plasmid#178272PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only