We narrowed to 8,572 results for: reporter
-
Plasmid#169315PurposeDoxycycline-inducible expression of miR-125b-2 with dTomato as reporter fluorescent proteinDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pIS1 mPELO
Plasmid#60805PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains PELO 3' UTR and mutated miR-155 sitesDepositorInsertPELO 3'UTR and mutated miR-155 binding site (PELO Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.mTagBFP2.let-7c
Plasmid#169310PurposeConstitutive overexpression of let-7c with mTagBFP2 as a reporter fluorescent proteinDepositorAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.mArid3a.IRES.GFP
Plasmid#169309PurposeConstitutive overexpression of murine Arid3a cDNA with GFP as reporter fluorescent proteinDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mATP2B1
Plasmid#60789PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ATP2B1 3' UTR and mutated miR-155 sitesDepositorInsertATP2B1 3'UTR and mutated miR-155 binding site (ATP2B1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/E2F2/NRF-1(-64)-like
Plasmid#66742Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationCGCG(-64) to TACAPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Enhancer-ZC3H12D_PromoterMUT
Plasmid#153068PurposeZC3H12D promoter region carrying mutations in BHLHE40 binding sites, cloned upstream of luciferase reporterDepositorInsertZC3H12D promoter region mutated in BHLHE40 binding sites (ZC3H12D Human)
UseLuciferaseExpressionMammalianMutationMutagenesis to disrupt 3 BHLHE40 binding sites. N…PromoterNoneAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLY54
Plasmid#130923PurposeA CRISPR activation device with the necessary genes (dcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA2B2 with sfgfp::ASV).DepositorInsertsdcas9
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterAnderson promoter: J23106, PpspA-LEA2B2, and PtetAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS2272
Plasmid#111898PurposessAAV genome with Ple342 (TUBB3 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIS1 LMBRD2
Plasmid#60800PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LMBRD2 3' UTR and wild-type miR-155 sitesDepositorInsertLMBRD2 3'UTR and wild-type miR-155 binding site (LMBRD2 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV_Dbh HMEJ donor
Plasmid#97320PurposeHMEJ donor for fusing a p2A-mCherry-WPRE reporter to mouse Dbh. AAV backbone.DepositorInsertDbh HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
161+80pCalb2/mutCREB(-2)-like
Plasmid#66751Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp +80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationGCGC (-2) to TAGAPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/mutNRF-1(-41)-like
Plasmid#66744Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationCGC (-41) to ATTPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/dmutNRF-1(-41;-35)-like
Plasmid#66741Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationCGCAGGCGC (-41;-35) to ATTAGGATTPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMS1430
Plasmid#29225PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mINSIG2
Plasmid#60799PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains INSIG2 3' UTR and mutated miR-155 sitesDepositorInsertINSIG2 3'UTR and mutated miR-155 binding site (INSIG2 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mELOVL6
Plasmid#60791PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ELOVL6 3' UTR and mutated miR-155 sitesDepositorInsertELOVL6 3'UTR and mutated miR-155 binding site (ELOVL6 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-nAChr-Alpha6-YFP
Plasmid#50483Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChr-alpha6 (Chrna6 Mouse)
TagsYFP fusion in M3-M4 loop (after residue A405)ExpressionMammalianMutationGly-Ala-Gly flexible linker flanking the YFP open…PromoterCMVAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mLMBRD2
Plasmid#60801PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LMBRD2 3' UTR and mutated miR-155 sitesDepositorInsertLMBRD2 3'UTR and mutated miR-155 binding site (LMBRD2 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A(partial)
Plasmid#53705PurposeLuciferase reporter assay for microRNA binding on CIP2A coding sequenceDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseAvailable SinceAug. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1162
Plasmid#29077PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceAug. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
Luc-Hdm4-3'UTR-F2d5
Plasmid#64018PurposeLuciferase reporter of human Hdm4 3'UTR F2 fragment mutant #5DepositorInsertHDMX (MDM4 Human)
ExpressionMammalianAvailable SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 ELOVL6
Plasmid#60790PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ELOVL6 3' UTR and wild-type miR-155 sitesDepositorInsertELOVL6 3'UTR and wild-type miR-155 binding site (ELOVL6 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIS1 LPIN1
Plasmid#60802PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LPIN1 3' UTR and wild-type miR-155 sitesDepositorInsertLPIN1 3'UTR and wild-type miR-155 binding site (LPIN1 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 PELO
Plasmid#60804PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains PELO 3' UTR and wild-type miR-155 sitesDepositorInsertPELO 3'UTR and wild-type miR-155 binding site (PELO Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1210
Plasmid#29107PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMiR-RECK-3'UTR-miR-7-mut
Plasmid#53692PurposeLuciferase reporter assay for RECK 3'UTR that has point mutations on miR-7 binding siteDepositorInsertRECK-3'UTR (RECK Human)
UseLuciferaseMutationnucleotide position 171-174 are mutated to GAAGAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 EPAS1
Plasmid#60792PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains EPAS1 3' UTR and wild-type miR-155 sitesDepositorInsertEPAS1 3'UTR and wild-type miR-155 binding site (EPAS1 Human)
UseLuciferaseExpressionMammalianPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1136
Plasmid#29056PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJC2745 - hPGK-EGFP-ZMAT2(C-term)-IRES2-mCherry-EF1A-Puro
Plasmid#250276PurposeRatiometric protein stability reporter for measuring C-terminal degron activity.DepositorInsertEGFP-ZMAT2(C-term)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJan. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJC2742 - hPGK-EGFP-SUGT1(C-term)-IRES2-mCherry-EF1A-Puro
Plasmid#250273PurposeRatiometric protein stability reporter for measuring C-terminal degron activity.DepositorInsertEGFP-SUGT1(C-term)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJC2743 - hPGK-EGFP-MTFR1L(C-term)-IRES2-mCherry-EF1A-Puro
Plasmid#250274PurposeRatiometric protein stability reporter for measuring C-terminal degron activity.DepositorInsertEGFP-MTFR1L(C-term)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJC2744 - hPGK-EGFP-GOPC(C-term)-IRES2-mCherry-EF1A-Puro
Plasmid#250275PurposeRatiometric protein stability reporter for measuring C-terminal degron activity.DepositorInsertEGFP-GOPC(C-term)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJC2741 - hPGK-EGFP-CycD1(C-term)-IRES2-mCherry-EF1A-Puro
Plasmid#250272PurposeRatiometric protein stability reporter for measuring C-terminal degron activity.DepositorInsertEGFP-CycD1(C-term)
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSRG12 (eft-3p::24xGCN4::t2a::tagbfp::h2b::tbb-2 3’UTR)
Plasmid#245120PurposeSunTag reporter for live imaging of translation (when combined with scFv::GFP expression) in C. elegansDepositorInsertseft-3p
24xGCN4
T2A
TagBFP (GLO)
H2B
tbb-2 3'UTR
right recombination arm MosSCI cxTi10816
Left recombination arm MosSCI cxTi10816
ExpressionBacterial and WormAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG2744
Plasmid#246340Purpose203-bp DIAL Reporter Plasmid with YB_TATA expressing mCherry-GS-HRasG12V in the presence of ZFa and editable by Cre recombinaseDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Rox-nlsKate5V-stop-Rox-myr-Flag-BFP-NEO (JDW 473)
Plasmid#242587PurposeA CAGGS driven, Dre recombinase dependent switch reporter (nls-mKate2 to MbBFP following Dre recombination).DepositorInsertnlsKateV5, MbBPF-FLAG, FRTNeoFRT
ExpressionMammalianPromoterCAGGSAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA(mut 8356-8370)](pAVA3874)
Plasmid#239353PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(WT)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(WT)-mascRNA(mut 8356-8370: ctacgaccacc…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRAF-V600E-IRES-mCherry
Plasmid#221026PurposeFluorescent reporter for expressing a segment of BRAF-V600E CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRAF-WT-IRES-mCherry
Plasmid#221027PurposeFluorescent reporter for expressing a segment of wild type BRAFDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA358_pAAV-SCP1-Intron-eGFP-CS1
Plasmid#215513PurposeSingle stranded AAV eGFP reporter vector with SCP1 promoter.DepositorInserteGFP
UseAAVExpressionMammalianPromoterSCP1Available SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-DIO-ExRai-AKAR2-T/A
Plasmid#171847PurposeCre-dependent, synapsin promoter-driven expression of the negative control phosphomutant ExRai-AKAR2 T/A PKA biosensor in neurons.DepositorInsertExRai-AKAR2 T/A
UseAAVExpressionMammalianMutationT6A phospho-deficient mutationPromoterhSyn1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI1
Plasmid#217367PurposeExpresses E. coli leucine tRNA variant "LeuIGI1" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI1" for TAG suppression
UseAAVExpressionMammalianMutationG6U, C78G, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-CMV-mCherry-1xU6-LeuIGI2
Plasmid#217368PurposeExpresses E. coli leucine tRNA variant "LeuIGI2" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli leucine tRNA mutant, "LeuIGI2" for TAG suppression
UseAAVExpressionMammalianMutationC2G, C3G, G6U, A7G, U77C, C78G, G81C, G82C, U83CPromoterU6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-FLAG-HAND1-T2A-mTagBFP2
Plasmid#223192PurposeEntry vector containing FLAG-HAND1 with a T2A-mTagBFP2 reporter (attL flanked)DepositorInsertHAND1 (HAND1 Human)
UsePromoterless entry vector for gateway cloningTagsFLAG and T2A-mTagBFP2ExpressionBacterialPromoterNoneAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Luciferase-P2A-H2A-mCherry (JDW 1129)
Plasmid#229823PurposeA CAGGS driven luciferase reporter followed by a P2A cleavage peptide and an H2A mCherry cassette for nuclear labeling.DepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only