We narrowed to 5,832 results for: ATC
-
Plasmid#12057DepositorInsertN3 3'UTR mut (YLPM1 Human)
UseLuciferaseTagsExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…PromoterAvailable sinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
JBL6424
Plasmid#183861PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Invader B regulated sfGFP
UseTagsExpressionBacterialMutationPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6427
Plasmid#183864PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Incumbent B regulated sfGFP
UseTagsExpressionBacterialMutationPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6419
Plasmid#183856PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Invader A regulated sfGFP
UseTagsExpressionBacterialMutationPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6422
Plasmid#183859PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Mismatch Incumbent A regulated sfGFP
UseTagsExpressionBacterialMutationPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330 - LRR1 Terminal CRISPR
Plasmid#221705PurposeCas9 targeting plasmid with gRNA specific for LRR1 N-terminusDepositorInsertTGTAGCTTCATCTCGCCCAA
UseCRISPRTagsExpressionMutationPromoterChicken Beta-actinAvailable sinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp4
Plasmid#238037PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp1
Plasmid#238034PurposeEncodes sfGFPunder lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp2
Plasmid#238035PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp3
Plasmid#238036PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp6
Plasmid#238039PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp5
Plasmid#238038PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsExpressionMutationPromoterlacAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…TagsExpressionMammalianMutationPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-SnoopTag-SpyTag-(AffiHER2)x3
Plasmid#216281PurposeThree affibodies to HER2 linked in a chain for bacterial expression. SnoopTag and SpyTag allow isopeptide bond formation to their cognate CatcherDepositorInsertSnoopTag-SpyTag-(AffiHER2)x3
UseAffinity Reagent/ AntibodyTagsHis6, SnoopTag, and SpyTagExpressionBacterialMutationPromoterT7 promoterAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorInsertGOLIM4 (GOLIM4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGGA-pCLV3
Plasmid#210528PurposeCloning A. thaliana CLV3 promoter as GreenGate module ADepositorInsertpCLV3 (CLV3 Mustard Weed)
UseSynthetic Biology; Golden gate compatible cloning…TagsExpressionMutationPromoterAvailable sinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210743PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 3DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 3- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210739PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 3DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationPromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 1- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210737PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 1DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationPromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210744PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 4DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only