We narrowed to 3,225 results for: sam
-
Plasmid#159630PurposeAAV expression of HA Allatostatin-3, neurophysin, IRES mCherry under the CAG promoterDepositorInsertAst (AstA Fly)
UseAAVTagsHA, IRES, mCherry, and neurophysin-1ExpressionMammalianPromoterDCA (same as CAG promoter)Available SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(47))-PGKpuro2ABFP-W
Plasmid#200510PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(47) (SMARCA2 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX307 hDVL1
Plasmid#102863PurposeExpresses human DVL1 in mammalian cellsDepositorInserthuman Dishevelled 1 (DVL1) (DVL1 Human)
UseLentiviralExpressionMammalianMutationChanged alanine 2 to glycine. Likely due to poly…PromoterEF1AAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF0383
Plasmid#141598PurposeLentiviral vector for overexpressing the SMARCA2 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NAGK
Plasmid#23785DepositorInsertNAGK (NAGK Human)
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
6MIW
Plasmid#127291PurposeBacterial expression for structure determination. May not contain entire coding region of geneDepositorAvailable SinceJune 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKK-BI16-FLAG-3C-ORF1_mClover3-TEV-ORF2
Plasmid#105801PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C or enterokinase; second protein expressed with mClover3, cleavable by TEV protease; tags positions: N-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: FLAG-3C; ORF2: mClover3-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Venus
Plasmid#105805PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Venus, cleavable by TEV. Useful for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-VenusExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF0380
Plasmid#142610PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKK-RNAi-nucEGFPmiR-FLAG-TEV
Plasmid#105807PurposeFunctional studies using RNAi; rescue experiments; substituting protein for its different form. miRNA cassette with nuclear EGFP expression marker; your protein of interest with N-terminal FLAG tag.DepositorTypeEmpty backboneUseRNAi; Flp-in competentTagsFLAG-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-ORF1-3C-FLAG_ORF2-TEV-mClover3
Plasmid#105803PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C protease; second protein expressed with mClover3, cleavable by TEV protease; tags positions: C-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-FLAG; ORF2: TEV-mClover3ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Amber
Plasmid#105806PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Amber, cleavable by TEV. Control for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-AmberExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-EV-IRES-Neo
Plasmid#253787PurposepLV lentiviral expression vector encoding empty vector linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-EV-IRES-Neo
Plasmid#253783PurposepLenti lentiviral expression vector encoding empty vector linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPGK-DEST-IRES-Puro
Plasmid#253773PurposeThird generation lentiviral expression Gateway cloning destination vector under a hPGK promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-DEST-IRES-Puro
Plasmid#253769PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-Puro
Plasmid#253777PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-TRE-DEST-UbC-tTSrtTA-IRES-Neo
Plasmid#253780PurposeThird generation lentiviral expression Gateway cloning destination vector under a Tet-On inducible promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-Neo
Plasmid#253776PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only