We narrowed to 495 results for: src
-
Plasmid#86428PurposeFluorescent human androgen receptor (fused to EGFP) with expanded polyglutamine regionDepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationPoly-glutamine expansion, G130DPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR Q0
Plasmid#86427PurposeFluorescent human androgen receptor (fused to EGFP) with deleted polyglutamine regionDepositorInsertandrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationDeletion of the poly-glutamine expansionPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_S94A-PolyA
Plasmid#112286PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) S94A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with Serine 94 to AlaninePromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRTagsExpressionMammalianMutationPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y357F-PolyA
Plasmid#112287PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y357F mutant _ corresponding to tyrosine 407 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationTyrosine 357 to Phenyalanine corresponding to tyr…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
Human Wild-type ASAP1
Plasmid#235212PurposeExpresses Wild-Type ASAP1 in mammalian cellsDepositorInsertASAP1 (ASAP1 Human)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_R89A-PolyA
Plasmid#112291PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) R89A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with Arginine 89 to AlaninePromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_L91A-PolyA
Plasmid#112292PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) L91A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with Leucine 91 to AlaninePromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_F95A-PolyA
Plasmid#112293PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) F95A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with Phenylalanine 95 to AlaninePromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_5SA-PolyA
Plasmid#112285PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) 5SA active mutant - serines 61, 109, 127, 164 and 397 (also known as 381 in other isoforms)DepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with 5 Serines (61, 109, 127, 1…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-AR C619Y
Plasmid#86429PurposeFluorescent human androgen receptor (fused to EGFP) with point mutation C619YDepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationC619YPromoterCMVAvailable sinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
SHIP2-ΔPS
Plasmid#214901Purposeexpression of the truncated variants of the SHIP2 without phosphatase domainDepositorInserthuman SHIP2 delta aa 419-739 (INPPL1 Human)
UseTagsV5/HisExpressionMammalianMutationdelta 419-739aaPromoterCMVAvailable sinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG_FBXL7
Plasmid#171848PurposepcDNA3-FLAG_FBXL7DepositorInsertF-box and leucine rich repeat protein 7 (FBXL7 Human)
UseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG_FBXL7 (R310H)
Plasmid#171849PurposepcDNA3-FLAG_FBXL7 (R310H)DepositorInsertF-box and leucine rich repeat protein 7 (FBXL7 Human)
UseTagsFlagExpressionMammalianMutationchanged Arginine 310 to HistidinePromoterAvailable sinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-ΔPR1
Plasmid#214902Purposeexpression of the truncated variants of the SHIP2 without first proline-rich domainDepositorInserthuman SHIP2 delta aa 123-410 (INPPL1 Human)
UseTagsV5/HisExpressionMammalianMutationdelta 123-410aaPromoterCMVAvailable sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only