We narrowed to 68,975 results for: nin
-
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
AviTag-His6-OAZ-SPM(FrpA 298-318)-GSG-SpyTag003
Plasmid#246647PurposeExpresses AviTag-His6-OAZ-SPM(FrpA 298-318)-GSG-SpyTag003 in bacterial cells for calcium-induced NeissLock protein ligationDepositorInsertAviTag-His6-OAZ-SPM(FrpA 298-318)-GSG-SpyTag003
TagsAviTag, His-tag, and SpyTag003ExpressionBacterialMutationOrinithine Decarboxylase Antizyme (OAZ) with C175…PromoterT7Available SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E mCherry-T2A-hsHRAS-G12V-pA (JDW 1188)
Plasmid#242571PurposeGateway 3' entry clone containing mCherry followed by a T2A cleavage peptide and then human HRAS G12V.DepositorInsertHRAS-G12V (HRAS Human)
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Sun1-2xsfGFP-6xMYC-pA (JDW 694)
Plasmid#242588PurposeA CMV driven expression vector containing a Sun1-2xsfGFP for labeling nuclear envenlope.DepositorAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-V5-mTagBFP2-KRAS4A-WT (JDW 831)
Plasmid#242568PurposeGateway middle entry clone containing an mTagBFP2 fused human KRAS4A WT.DepositorInsertKRAS4A (WT) (KRAS Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-V5-mClover-KRAS4A-WT (JDW 812)
Plasmid#242566PurposeGateway middle entry clone containing an mClover3 fused human KRAS4A WT.DepositorInsertKRAS4A (WT) (KRAS Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
cDNA5-FRT/TO-APT2-LAMA-F98
Plasmid#234427PurposeExpress APT2 with a C terminal fusion to the GFP enhancer nanobody containing dihydrofolate reductase inserted in the nanobody at position F98DepositorInsertAPT2 fused to the GFP enhancer nanobody containing dihydrofolate reductase inserted in the nanobody at position F98 (LYPLA2 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-APT2-LAMA-G97
Plasmid#234426PurposeExpress APT2 with a C terminal fusion to the GFP enhancer nanobody containing dihydrofolate reductase inserted in the nanobody at position G97DepositorInsertAPT2 fused to the GFP enhancer nanobody containing dihydrofolate reductase inserted in the nanobody at position G97 (LYPLA2 Human)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
YjdC-R82A_pET-14b
Plasmid#233276PurposeOverexpress his-tag YjdC protein with a site directed mutagenesis, arginine at position 82 was substituted with alanine (R82A)DepositorInsertYjdC (yjdC )
ExpressionBacterialMutationArginine was replaced with Alanine at position 82…PromoterT7 promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
YjdC-R64A_pET-14b
Plasmid#233263PurposeOverexpress his-tag YjdC protein with a site directed mutagenesis, arginine at position 64 was substituted with alanine (R64A)DepositorInsertYjdC (yjdC )
ExpressionBacterialMutationArginine was replaced with Alanine at position 64…PromoterT7 promoterAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
HemH-R212A_pET-14b
Plasmid#233262PurposeOverexpress his-tag HemH protein with a site directed mutagenesis, arginine at position 212 was substituted with alanine (R121A)DepositorInsertHemH (hemH )
ExpressionBacterialMutationArginine was replaced with Alanine at position 21…PromoterT7 promoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lsl-EGFP-nls-mCherry:fli1aep-CreI-zf1-BFP (JDW 1236)
Plasmid#229816PurposeA Tol2 based expression vector containing an Ubi driven loxP flanked GFP followed by an nls-mCherry reporter with fli1-TagBFP-zCre in the opposite direction.DepositorInsertloxp-EGFP-stop-lox
UseTol2 based expression vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2R)-NE
Plasmid#215487PurposeLentiviral expression of mutated alpha-synuclein (2nd amino acid aspartate mutated to arginine) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsNE tagExpressionMammalianMutationD (second aa) mutated to RPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2R)-GFP
Plasmid#215490PurposeLentiviral expression and easy visualization of mutated alpha-synuclein (2nd amino acid aspartate mutated to arginine) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsEGFPExpressionMammalianMutationD (second aa) mutated to RPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Myc-Bnip3-T181A
Plasmid#197556PurposeMammalian expression of myc-tagged mouse Bnip3 with an alanine substitution of threonine-181. Based on Myc-Bnip3FL (#100796)DepositorInsertBCL2 Interacting Protein 3 (Bnip3 Mouse)
TagsMycExpressionMammalianMutationThreonine 181 changed to alaninePromoterCMVAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L188A/L192A
Plasmid#108288PurposeExpresses residues 186-199 with L to A mutations at residues 188 and 192 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-286DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199 L192A/L195A
Plasmid#108290PurposeExpresses residues 186-199 with L to A mutations at residues 192 and 195 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-287DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated N-terminal (N) O-Glycosylation site
Plasmid#120404Purposeenables eukaryotic expression of human plasma fibronectin in which the first O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContaining complete variable region with a mutati…PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only