We narrowed to 70,249 results for: nin
-
Plasmid#61365Purposeencodes N. meningiditis dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664) driven by CMV promoterDepositorInsertNm-dCas9-p300 Core (EP300 Human, Neisseria meningiditis, Synthetic)
UseCRISPR and Synthetic BiologyTagsHA tag and NLSExpressionMammalianMutationD16A, D587A, H588A, N611A in Nm Cas9PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTol2-fli1-lsl-AmCyan-mScarlet; hsp70-zfCre-I-BFP (JDW 1234)
Plasmid#229810PurposeA Tol2 based expression vector containing fli1 driven switch reporter (loxP flanked AmCyan followed by a mScarlet-I) and a hsp70-TagBFP-zCre in the opposite direction.DepositorInsertloxp-AmCyan-stop-lox
UseTol2 based expression vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lsl-EGFP-nls-mCherry-hsp70-zCreI-mTagBFP2 (JDW 1235)
Plasmid#229814PurposeA Tol2 based expression vector containing an Ubi driven loxP flanked GFP followed by an nls-mCherry reporter with hsp70-TagBFP-zCre in the opposite direction.DepositorInsertloxp-EGFP-stop-lox
UseCre/Lox; Tol2 based expression vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Jaws-KGC-tdTomato-ER2]
Plasmid#153536PurposeAAV-mediated expression of Jaws-KGC-tdTomato-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterSynAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX-rc [Jaws-KGC-GFP-ER2]
Plasmid#78174PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the human synapsin promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterhuman synapsinAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKE4-I-SceI-fabp10a:Xpt-β-cat, cryaa:Venus
Plasmid#105127PurposeUsed along with I-SceI enzyme to generate transgenic zebrafish expressing hepatocyte-specific Xenopus activated beta-catenin and lens-specific Venus fluorescent proteinDepositorInsertsUseZebrafish transgenesisPromotercryaa (crystallin) and fabp10aAvailable SinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
CXCR4-DuET
Plasmid#213221PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Jaws-KGC-GFP-ER2
Plasmid#99233PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the CAG promoter. Using bGH pA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterCAGAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Jaws-KGC-GFP-ER2
Plasmid#153537PurposeAAV-mediated expression of Jaws-GFP-ER2 under the EF1α promoter (1.1kb short version).DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterEF1α1.1Available SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
CCR6-DuET
Plasmid#213202PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUltraHot-mCherry-BLM-WT
Plasmid#206966Purposeexpressing the protein BLM fused to mCherry in human cellsDepositorInsertBloom Syndrome RecQ Like Helicase (BLM Human)
UseLentiviralTagsmCherryExpressionMammalianAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Jaws-KGC-tdTomato-ER2
Plasmid#153538PurposeAAV-mediated expression of Jaws-tdTomato-ER2 under the EF1α promoter (1.1kb short version).DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterEF1α1.1Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Prom1-TEVp-TwinStrep-His / IRES2 / Pcdh21-TEVp-Myc-Flag
Plasmid#210820PurposeMammalian overexpression vector for polycistronic co-expression of C-terminally Strep and His tagged human Prom1s1 (WT) and C-terminally Myc and Flag tagged human Pchd21 (WT)DepositorTagsMyc, 3xFlag and TwinStrep, 10xHisExpressionMammalianPromoterCMV and CMV / IRES2Available SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5LdeltaER-SBP-mCitrine
Plasmid#154846PurposeSynchronize trafficking of Stx5LdeltaER (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Long isoform) (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-IRES_ECFP
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
AviTag-His6-OAZ-SPM(FrpA 298-318)-GSG-SpyTag003
Plasmid#246647PurposeExpresses AviTag-His6-OAZ-SPM(FrpA 298-318)-GSG-SpyTag003 in bacterial cells for calcium-induced NeissLock protein ligationDepositorInsertAviTag-His6-OAZ-SPM(FrpA 298-318)-GSG-SpyTag003
TagsAviTag, His-tag, and SpyTag003ExpressionBacterialMutationOrinithine Decarboxylase Antizyme (OAZ) with C175…PromoterT7Available SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E mCherry-T2A-hsHRAS-G12V-pA (JDW 1188)
Plasmid#242571PurposeGateway 3' entry clone containing mCherry followed by a T2A cleavage peptide and then human HRAS G12V.DepositorInsertHRAS-G12V (HRAS Human)
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Sun1-2xsfGFP-6xMYC-pA (JDW 694)
Plasmid#242588PurposeA CMV driven expression vector containing a Sun1-2xsfGFP for labeling nuclear envenlope.DepositorAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only