We narrowed to 68,975 results for: nin
-
Plasmid#162499PurposeExpresses GFP tagged Tac mutant in mammalian cells. The five O-glycosylation sites in the stem region are mutated, and the stem region of CD8a with mutations is inserted between GFP and Tac(5A).DepositorInsertTagsGFPExpressionMammalianMutationThe five theronine and two serine residues are mu…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pDONR221-EWSR1 g1750a No Stop
Plasmid#84894PurposeDONOR vector for Gateway cloning of EWSR1 g1750a No StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1750a Stop
Plasmid#84893PurposeDONOR vector for Gateway cloning of EWSR1 g1750a StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 c1655t Stop
Plasmid#84891PurposeDONOR vector for Gateway cloning of EWSR1 c1655t StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pScaffold-H1 donor
Plasmid#118152PurposePCR template for dual guide RNA cloning, guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system - H1 promoterDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 c1222t No Stop
Plasmid#84900PurposeDONOR vector for Gateway cloning of TAF15 c1222t No StopDepositorAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475RG502R-AVI
Plasmid#160480PurposeExpresses SARS-CoV-2 RBD-L455RA475RG502R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475RG502R
TagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine, Alanine 475 to A…Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 g1172a No Stop
Plasmid#84898PurposeDONOR vector for Gateway cloning of TAF15 g1172a No StopDepositorAvailable SinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTKA001
Plasmid#164577PurposeExpresses SARS-CoV-2 nsp7 from a pET46 backbone for IPTG-inducible bacterial expressionDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTKA002
Plasmid#164578PurposeExpresses SARS-CoV-2 nsp8 from a pET46 backbone for IPTG-inducible bacterial expressionDepositorInsertnsp8
Tags6xHis, Ek, TEVExpressionBacterialPromoterT7 PromoterAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
piggyBac-rtTA (4th_Gen)-sfGFP-IRES-NGN2-puro (VK_1122)
Plasmid#209079PurposeNgn2 mediated cortical neuron induction, along with sfGFP over-expressionDepositorAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUAP1
Plasmid#63674PurposeAccepts DNA sequences via BpiI cloning sites, resulting in Level 0 standard parts for Golden Gate cloning. Parts can be released with a user-defined 4-base-pair, 5 prime overhangs using BsaI.DepositorInsertRFP cloning selection cassette
UseSynthetic BiologyAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPtPBR11_fcpShble_GWB
Plasmid#154031PurposeGateway cloning into P. tricornutum episomal vectorDepositorTypeEmpty backboneUseDiatom cloningAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTpPBR11_fcpNAT_GWB
Plasmid#154032PurposeGateway cloning into T. pseudonana episomal vectorDepositorTypeEmpty backboneUseDiatom cloningAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTpPBR11_accNAT_GWB
Plasmid#154033PurposeGateway cloning into T. pseudonana or C. cryptica episomal vectorDepositorTypeEmpty backboneUseDiatom cloningAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pMC-dest-BsaI-cmlc2:mCherry
Plasmid#241213DepositorTypeEmpty backboneUseMinicircle cloning vectorMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE2 EGFP
Plasmid#129435Purposeexpress GFPDepositorInsertGFP
ExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST-attB
Plasmid#30325DepositorInsertphiC31 attB site
UseDrosophila transgenesisAvailable SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only