We narrowed to 70,249 results for: nin
-
Plasmid#114443PurposeEntry vector for gateway cloning containing human JARID2 coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only
-
RMCE ABCDE>ala DNA-PKcs
Plasmid#233914PurposeLow copy number provides expression of human DNA-PKcs with the 6 ABCDE phosphorylation sites substituted to alanine.DepositorInserthuman DNA-PKcs ABCDE phosphorylation site mutant (PRKDC Human)
ExpressionMammalianMutationphosphorylation sites 2609, 2612, 2620, 2624, 263…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-V5-mClover-KRAS4A-G12D (JDW 813)
Plasmid#242567PurposeGateway middle entry clone containing an mClover3 fused human KRAS4A G12D.DepositorInsertKRAS4A-G12D (KRAS Human)
UseGateway subcloningAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 Stop
Plasmid#84887PurposeDONOR vector for Gateway cloning of EWSR1DepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-GenRep
Plasmid#214674PurposeMAPT Exon 10 reporter, with Exon 10 and 100bp flanking intronic regions replaced with a BamHI/EcoRI cloning site for testing different exonsDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9 and Exon 11, with a BamHI EcoRI c…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 c1655t No Stop
Plasmid#84892PurposeDONOR vector for Gateway cloning of EWSR1 c1655t No StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1532c No Stop
Plasmid#84890PurposeDONOR vector for Gateway cloning of EWSR1 g1532c No StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 No Stop
Plasmid#84888PurposeDONOR vector for Gateway cloning of EWSR1 No StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR8 PALI1
Plasmid#114442PurposeEntry vector for gateway cloning containing human PALI1 coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR8 LCOR
Plasmid#114441PurposeEntry vector for gateway cloning containing human LCOR coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 No Stop
Plasmid#84896PurposeDONOR vector for Gateway cloning of TAF15 No StopDepositorAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
tPA-TGFa-SPMn-SpyTag003
Plasmid#246649PurposeExpresses tPA-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInserttPA-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Kringl…PromoterCMV promoterAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Cstem(7A)-Tac(5A)
Plasmid#162499PurposeExpresses GFP tagged Tac mutant in mammalian cells. The five O-glycosylation sites in the stem region are mutated, and the stem region of CD8a with mutations is inserted between GFP and Tac(5A).DepositorInsertTagsGFPExpressionMammalianMutationThe five theronine and two serine residues are mu…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1750a No Stop
Plasmid#84894PurposeDONOR vector for Gateway cloning of EWSR1 g1750a No StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1750a Stop
Plasmid#84893PurposeDONOR vector for Gateway cloning of EWSR1 g1750a StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 c1655t Stop
Plasmid#84891PurposeDONOR vector for Gateway cloning of EWSR1 c1655t StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pScaffold-H1 donor
Plasmid#118152PurposePCR template for dual guide RNA cloning, guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system - H1 promoterDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 c1222t No Stop
Plasmid#84900PurposeDONOR vector for Gateway cloning of TAF15 c1222t No StopDepositorAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only