We narrowed to 4,547 results for: BRE
-
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX302 PCSK5 (T288P)-V5 puro
Plasmid#98709PurposeLentiviral vector for constitutive expression of human mutant PC5A (T288P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Threonine 288 to ProlineAvailable SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
10xHis-ataxin-3 *SIM-HA
Plasmid#89983PurposeExpresses His- and HA-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorInsertataxin-3 (ATXN3 Human)
Tags10xHis and HAExpressionMammalianMutationmutated aa 162IFVV to 162AFAAAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *SIM
Plasmid#89979PurposeExpresses GFP-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorInserteGFP-SUNΔN
ExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDRM210 LGP (Luciferase GFP Puro)
Plasmid#174722PurposeExpresses the firefly luciferase gene, E2A, eGFP, F2A, and the puromycin resistance geneDepositorInsertsFirefly Luciferase
eGFP
pac
UseLentiviral and LuciferaseTagsE2A linker and F2A linkerExpressionMammalianPromoterMND, MND (off Luc-E2A), and MND (off Luc-E2A-eGFP…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 puro
Plasmid#104994PurposeThis 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.neo_shGFP
Plasmid#110470PurposeControl, silence GFP gene, doxycycline inducible, neomycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
PARP1 FL
Plasmid#169815PurposeExpresses codon optimised full length His tagged PARP1 in bacterial cellsDepositorInsertPoly[ADP-ribose] polymerase 1 (PARP1 Human, Codon optimised, Synthetic)
TagsMKHHHHHHMKQExpressionBacterialMutationValine 762 mutated to an alaninePromoterT7 promoterAvailable SinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 hygro
Plasmid#104995PurposeThis lentiviral construct delivers hSpCas9 and hygromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDRM166 LKB (Luciferase mKate2 Blast)
Plasmid#183502PurposeExpresses the firefly luciferase gene, the NLS-tagged mKate2 gene, and the blasticidin resistance gene joined by P2A linkers.DepositorInsertsFirefly Luciferase
mKate2
BSD
UseLentiviral and LuciferaseTagsP2A linker and SV40 NLS with GGS linkerExpressionMammalianPromoterMND, MND (off Luc-P2A), and MND (off Luc-P2A-mKat…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-CMV-Flag-SREBP-1c
Plasmid#237348PurposeAdenoviral-SREBP-1c cleavage-activation reporter systemDepositorAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-wtYAP
Plasmid#84009Purposeexpresses wtYAP in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 blast
Plasmid#104997PurposeThis lentiviral construct delivers hSpCas9 and blasticidin S resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
NanoLuc-TCF4(biased)-beta-Catenin-HaloTag Bidirectional Vector
Plasmid#238680PurposeExpress NanoLuc-TCF4(biased)-beta-Catenin-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationbiasedPromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDRM18 LTN (Luciferase tdTomato Neo)
Plasmid#174721PurposeExpresses the firefly luciferase gene, E2A, tdTomato, P2A, and the neomycin resistance gene.DepositorInsertsFirefly Luciferase
tdTomato
aph
UseLentiviral and LuciferaseTagsE2A linker and P2A linkerExpressionMammalianPromoterMND, MND (off Luc-E2A), and MND (off Luc-E2A-tdTo…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-eHGT_78h-Cre_PEST
Plasmid#231791PurposeExpresses Cre in excitatory neurons; Cre expression is attenuated by PEST sequence.DepositorInsertCre
UseAAVTagsPESTPromoterminBetaGlobinAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only