We narrowed to 6,118 results for: RIK
-
Plasmid#184014PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 671 to 685.DepositorInsertProm1 SV8(-Ex19a) D-2 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Prom1 D-3
Plasmid#184015PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 661 to 675.DepositorInsertProm1 SV8(-Ex19a) D-3 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Prom1 D+4
Plasmid#184023PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 731 to 745.DepositorInsertProm1 SV8(-Ex19a) D+4 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-mtIF3(SR)-3xFLAG-CMVp-mito-mTFP1
Plasmid#182380PurposeDual expression construct encoding shRNA-resistant mtIF3 and mito-mTFP1 from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterCMV promoter and SV40 promoterAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-CMVp-mito-mTFP1
Plasmid#182378PurposeDual expression construct encoding shRNA-resistant mtIF3 and mito-mTFP1 from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterCMV promoter and SV40 promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-HSVTKp-mCherry
Plasmid#182379PurposeDual expression construct encoding shRNA-resistant mtIF3 and mCherry from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterHSV TK promoter and SV40 promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT5T_Rev7_1-211_SA112_KVK_Champ1_328-355
Plasmid#105638PurposeExpresses mouse monomeric Rev7 and fragment of Champ1 protein (amino acids 328-355) from bicistronic plasmidDepositorExpressionBacterialMutationMutations: F11S, G12A, V132K, C133V, A135KPromoterT7Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
p406 – TDH3-ER-FlucDM-GFP11-Ura
Plasmid#177731PurposeDM Firefly luciferase reporter fused to a KAR2 signal sequence for ER targeting and HDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminus in yeast plasmid withDepositorInsertFlucDM
TagsGFP11, HA, HDEL, and KAR2 Signal SequenceExpressionBacterial and YeastMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-tapasinCT I261A
Plasmid#153476PurposeMammalian expression of FLAG-tagged TAPBPR with tapasin CT I261ADepositorInsertTAPBPR (TAPBPL Human)
TagsFLAGExpressionMammalianMutationC terminal tail of tapasin, I261APromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-tapasinCT S333A
Plasmid#153477PurposeMammalian expression of FLAG-tagged TAPBPR with tapasin CT S333ADepositorInsertTAPBPR (TAPBPL Human)
TagsFLAGExpressionMammalianMutationC terminal tail of tapasin, S333APromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-tapasinCT
Plasmid#141309PurposeMammalian expression of FLAG-tagged TAPBPR with tapasin CTDepositorInsertTAPBPR (TAPBPL Human)
TagsFLAGExpressionMammalianMutationC terminal tail of tapasinPromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-tapasinCT deltaALAS
Plasmid#153471PurposeMammalian expression of FLAG-tagged TAPBPR with tapasin CT deltaALASDepositorInsertTAPBPR (TAPBPL Human)
TagsFLAGExpressionMammalianMutationC terminal tail of tapasin, deletion of amino aci…PromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-tapasinCT delta24-36
Plasmid#153472PurposeMammalian expression of FLAG-tagged TAPBPR with tapasin CT delta24-36DepositorInsertTAPBPR (TAPBPL Human)
TagsFLAGExpressionMammalianMutationC terminal tail of tapasin, deletion of amino aci…PromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-tapasinCT E102A
Plasmid#153473PurposeMammalian expression of FLAG-tagged TAPBPR with tapasin CT E102ADepositorInsertTAPBPR (TAPBPL Human)
TagsFLAGExpressionMammalianMutationC terminal tail of tapasin, E102APromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-tapasinCT M122A
Plasmid#153474PurposeMammalian expression of FLAG-tagged TAPBPR with tapasin CT M122ADepositorInsertTAPBPR (TAPBPL Human)
TagsFLAGExpressionMammalianMutationC terminal tail of tapasin, M122APromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-tapasinCT G212A
Plasmid#153475PurposeMammalian expression of FLAG-tagged TAPBPR with tapasin CT G212ADepositorInsertTAPBPR (TAPBPL Human)
TagsFLAGExpressionMammalianMutationC terminal tail of tapasin, G212APromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Cd155 shRNA2
Plasmid#166488PurposeMouse Cd155 RNAiDepositorInsertshRNA for mouse Cd155 (Pvr Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Cd155 shRNA1
Plasmid#166487PurposeMouse Cd155 RNAiDepositorInsertshRNA for mouse Cd155 (Pvr Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdc20
Plasmid#160954PurposeCdc20 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shAspm
Plasmid#160947PurposeAspm shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdkn3
Plasmid#160955PurposeCdkn3 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTCO2-mTDGi.2
Plasmid#149431PurposeminiTdg gene, SUMOylation mutantDepositorInsertTdg (Tdg Mouse)
UseCre/LoxExpressionMammalianMutationK341A SUMOylation mutant, SNPs of Tdg gene in OLA…PromoterTdg promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTCO2-mTDGi.1
Plasmid#149430PurposeminiTdg gene, catalytic mutantDepositorInsertTdg (Tdg Mouse)
UseCre/LoxExpressionMammalianMutationN151A catalytic mutant, SNPs of Tdg gene in OLA/1…PromoterTdg promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9n-Nanog-R
Plasmid#122303PurposeExpresses sgRNA targeting mouse Nanog and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic, Mouse)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBOB-N-Flag-Snrnp40
Plasmid#134249PurposeLentivector encoding Flag-tagged Snrnp40DepositorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-A
Plasmid#138670PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-B
Plasmid#138671PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-B15-VN
Plasmid#135514PurposeMammalian expression of VN-fused and myc-tagged HLA-B*15:01DepositorInsertHLA-B*15:01 (HLA-B Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-B57-VN
Plasmid#135515PurposeMammalian expression of VN-fused and myc-tagged HLA-B*57:01DepositorInsertHLA-B*57:1 (HLA-B Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only