We narrowed to 27,048 results for: STI
-
Plasmid#217800PurposeVariant CE1 construct with engineered M-MLV reverse transcriptase (RT; found in PE2), expressed from CMV or T7 promotersDepositorInsertPCV2-XTEN-nSpCas9-BPNLS-M-MLV(PE2)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); PE2 M-MLV(D200N/L603W/T330P/T306K…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-BsdCas9-W
Plasmid#67978PurposeLentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the N-terminusDepositorInsertEF1a-Cas9 cassette, WPRE
UseCRISPR and LentiviralTagsCas9 fused with Flag-tag and a NLS at the N termi…PromoterEF1aAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1(201R2)-IV
Plasmid#102421PurposeInducible expression of siRNA resistant mouse Tet1-201 (Ensembl transcript ENSMUST00000050826.13) with HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 (Tet1 Mouse)
TagsHAExpressionMammalianMutationModified at the Dharmacon SMARTpool siRNA #2 targ…PromoterTetO-CMVAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1mHxD(201R2)-IV
Plasmid#102422PurposeInducible expression of siRNA resistant mouse Tet1-201 (ENSMUST00000050826.13) with mutated catalytic domain (H1620Y & D1622A), HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 catalytic domain mutant (Tet1 Mouse)
TagsHAExpressionMammalianMutationH1620Y and D1622A mutations in Tet1 catalytic dom…PromoterTetO-CMVAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-ePhi29(+exo) (LM2990)
Plasmid#208958PurposeA variant CE1 construct with ePhi29 DNA polymerase (exo active), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-ePhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); ePhi29(M8R/V51A/M97T/G197D/E221K/…PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-CMV-Cre-U6-sgX-U6-sgRb1-U6-sgTrp53-U6-sgRbl2
Plasmid#209060PurposeEntry cloning vector to insert an sgRNA of interest (using Esp3i digestion) into a vector that already contains sgRNAs against mouse Rb1, Trp53, and Rbl2 and CMV Cre recombinase.DepositorInsertsgRNAs targeting Rb1, Trp53, Rbl2 and Cre recombinase
UseGateway vector to be used for lr reactionPromoterU6Available SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
HA-hDAGLa-V5
Plasmid#87674PurposeExpresses human DAGLa protein with a HA tag inserted in the first extracellular loop, and intracellular V5 tag located on the C-terminalDepositorInsertHuman Diacylglycerol Lipase Alpha (DAGLA Human)
TagsHA and V5 tagExpressionMammalianMutationHemagglutinin (HA) peptide sequence (YPYDVPDYA) f…PromoterT7Available SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-ePhi29 fusion - pCMV-T7-PCV2-ePhi29 (JO1420)
Plasmid#217805PurposeUnfused click editor construct expressing PCV2-ePhi29(D169A), expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(D169A/M8R/V51A/M97T/G197D/E221K/Q497P/K512E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-mFzd4
Plasmid#102866PurposeExpresses mouse Fzd4 in mammalian cellsDepositorInsertFrizzled 4 (Fzd4 Mouse)
UseLentiviralExpressionMammalianMutationT to C substitution at nucleotide 1149 of Fzd4 OR…PromoterEF1AAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-NTID194-GSQ-PMLiva3MAS-P2A-BLAST
Plasmid#208039PurposeEnables constitutive expression of N-terminal Split-TurboID-fused PML (isoform IVa; 3MAS mutant; K>R sumoylation sites, mutated SIM); selection with blasticidinDepositorInsertPML (isoform IVa; 3MAS) (PML Human)
UseLentiviralTagsFLAG, N-terminal Split-TurboIDMutation3MAS mutant: K65R, K160R and K490R; mutated SIMPromoterEFSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD hCPS1 AD
Plasmid#188130PurposeExpresses C-terminal flag-tagged human CAD hCPS1 AD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-mFzd9
Plasmid#102877PurposeExpresses mouse Fzd9 in mammalian cellsDepositorInsertFrizzled 9 (Fzd9 Mouse)
UseLentiviralExpressionMammalianMutationA to G substitution at nucleotide 114, G to A sub…PromoterEF1AAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Myc-gamma2S/deltaIL
Plasmid#119730PurposeGABAA receptor expression (chimeric rat gamma2 short subunit whose large intracellular loop has been replaced with the large intracellular loop of the rat delta subunit) Myc-tag near N-terminusDepositorTagscMyc epitope EQKLISEEDL inserted between fourth a…ExpressionMammalianAvailable SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing mSA for template recruitment and ePhi29 DNA polymerase - pCMV-T7-mSA-nCas9-ePhi29 (JO1398)
Plasmid#217803PurposeVariant CE1 construct with mSA for template recruitment and ePhi29(D169A) DNA pol, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-nSpCas9-BPNLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); Phi29(D169A/M8R/V51A/M97T/G197D/E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; mSA-ePhi29 - pCMV-T7-mSA-Phi29 (JO1411)
Plasmid#217807PurposeUnfused click editor construct expressing mSA-ePhi29(D169A), expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationPhi29(D169A/M8R/V51A/M97T/G197D/E221K/Q497P/K512E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing Cdc13 for template recruitment - pCMV-T7-Cdc13-nCas9-EcKlenow (JO1293)
Plasmid#217796PurposeVariant CE1 construct with Cdc13 telomere binding protein for template recruitment, expressed from CMV or T7 promoters.DepositorInsertCdc13-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing Cdc13(Y556A) for template recruitment - pCMV-T7-Cdc13(Y556A)-nCas9-EcKlenow (JO1329)
Plasmid#217797PurposeVariant CE1 construct with Cdc13(Y556A) telomere binding protein for template recruitment, expressed from CMV or T7 promoters.DepositorInsertCdc13(Y556A)-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationCdc13(Y556A); nSpCas9(H840A); EcKlenow(-exo;D355A…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Allosteric Domain
Plasmid#169835PurposeExpresses C-terminal flag-tagged CAD with substitution of allosteric domain F1308 - C1455 with a (GGGS)X3 linkerDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationSubstitution of amino acids F1308 - C1455 with a …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-2-seed
Plasmid#184535PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only