We narrowed to 6,754 results for: hwa
-
Plasmid#25704DepositorInsertAxin 2 promoter (AXIN2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationTCF DNA binding site at bp -108 to -102 mutated …Available SinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q927P4
Plasmid#103131PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ927P4(Cas9 coding gene from Listeria innocua serovar 6a (strain CLIP 11262))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Opto-GPR150
Plasmid#106050PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR150; Opto-GPR150; E4)DepositorInsertOpto-GPR150 (GPR150 Bovine, Human)
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RNF138-delta 18-58
Plasmid#78921PurposeMammalian expression of RNF138 with delta 18-58 and an EGFP fusionDepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPPAT-11AA-2XStrep
Plasmid#125680Purposeexpresses human PPAT protein, with first 11 residues removed, with a C-terminal 2XStrep affinity tagDepositorInsertPPAT (PPAT Human)
Tags2X Strep-Tag IIExpressionMammalianMutationthe first eleven residues have been removedPromoterCMVAvailable SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRD408
Plasmid#178199PurposeExpression of H-NS from its natural promoterDepositorAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Y771F EphA2 pcDNA3
Plasmid#102735PurposeExpression of EphA2 in mammalian cellsDepositorAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Y593E EphA2 pcDNA3
Plasmid#102731PurposeExpression of EphA2 in mammalian cellsDepositorAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-MKL1 D301-380
Plasmid#19852DepositorAvailable SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
TOB1
Plasmid#156089PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
CPSF4L
Plasmid#155479PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
SFRS17A-1
Plasmid#156011PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLRG1
Plasmid#155827PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
XE252 pCDNA3.1(zeo)-hDsh3-333-716
Plasmid#16757DepositorAvailable SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
XE255 pCDNA3.1(zeo)-hDsh3-truncPDZ
Plasmid#16754DepositorInsertFLAG-hDsh3-trunc before PDZ (DVL3 Human)
TagsflagExpressionMammalianMutationtruncated before PDZAvailable SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
TTR C10S S100C
Plasmid#190010PurposeExpression of human TTR in E coliDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiR-96 cluster promoter
Plasmid#62517PurposemicroRNA 183-96-182 cluster promoter luciferase plasmidDepositorInsertpromoter of microRNA-183-96-182 cluster
TagsRenSP (optimized renilla luciferase gene)ExpressionMammalianAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only