We narrowed to 2,515 results for: gcg
-
Plasmid#159905PurposeMutagenesis of Slc32a1DepositorInsertSlc32a1 (Slc32a1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi-D2
Plasmid#182927Purposeinducible CRISPRi plasmid with gRNA targeting to psbD gene in Synechocystis 6803DepositorInsertddcpf1
UseCRISPRAvailable SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUCSh5vio-2300
Plasmid#170987PurposeEncodes sgRNA target 2300 and Gentamicin resistance - violacein pathway transposon.DepositorInsertSh-CAST sgRNA 2300 violacein
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterplacIAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro PRMT5-CRISPRi
Plasmid#164637PurposelentiGuide-Puro backbone with cloned target sequence for human PRMT5. The insert is: 5´- CACCGAGCCGCGTGTCCAGCGGGA-3. sgRNA achieves a downregulation of PRMT5 in combination with dCAS9-KRAB-MCP2DepositorInserttarget guide sequence PRMT5 inhibition (PRMT5 Human)
UseCRISPR and Lentiviral; InterferenceExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPB_1
Plasmid#64036PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRPromoterU6Available SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-L3US2-RFP-HDAC3
Plasmid#83966PurposeLentiviral CRISPR HDAC3 dual gRNA targeting vectorDepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA5
Plasmid#100557PurposeExpresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGCDepositorInsertMYC sgRNA5
PromoterU6Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA4
Plasmid#100556PurposeExpresses MYC sgRNA4. Target sequence: GTAATTCCAGCGAGAGGCAGDepositorInsertMYC sgRNA4
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUCSh2-2300
Plasmid#170984PurposeEncodes sgRNA target 2300 and Kanamycin resistance transposon.DepositorInsertSh-CAST sgRNA 2300
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCSh3-2300
Plasmid#170985PurposeEncodes sgRNA target 2300 and Tetracycline resistance transposon.DepositorInsertSh-CAST sgRNA 2300
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWT049d
Plasmid#96862Purposeguanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsertguanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWT049e
Plasmid#96863Purpose(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)DepositorInsert(d)guanine-agRNA (19 nt blocker with bulges, RFP activation)
ExpressionMammalianAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-ctrl
Plasmid#85741PurposeshRNA ctrlDepositorInsertshRNA ctrl
UseAAVTagsEYFPAvailable SinceApril 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-L1221
Plasmid#101335Purposenegative control for knockdowns target site: CTTGTCGATGAGAGCGTTTGTDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP
Plasmid#84254PurposeExpresses optimized Sa sgCXCR4-1 gRNA with an EGFP fluorescent markerDepositorInsertSa sgCXCR4-1
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA
Plasmid#121954PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
OA-1050G (white)
Plasmid#132420Purposeexpress arrays of gRNA targeting White under dU6-3 promoterDepositorInsertwhite gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTGMP-p16/p19.478
Plasmid#32717DepositorInsertp16/p19
UseRNAi and RetroviralExpressionMammalianAvailable SinceAug. 1, 2012AvailabilityAcademic Institutions and Nonprofits only