We narrowed to 3,846 results for: 28
-
Plasmid#175068Purposeexpresses FUS wildtype tagged to mVenus and mCherry in mammalian cellsDepositorInsertFUS glycine rich protein (FUS Human)
TagsHA and mVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.D2-NP
Plasmid#134366PurposeNanoluc complementation assay. Expression of dopamine receptor D2 fused at C terminus with Natural peptide (NP) of NanoLuc. Addition of the signal sequence and Flag epitope at N terminus of D2.DepositorInsertD2-NP (DRD2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTMB304_ZFcharm_Kv1_Prnp_SCR
Plasmid#220842PurposeAAV genome expressing ZFcharm Kv1 targeting Prnp; scrambled self-silencing binding siteDepositorInsertZFcharm Kv1
UseAAVTagsHAtagExpressionMammalianMutationN/APromoterEFSAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gα12-LgB115
Plasmid#134363PurposeNanoluc complementation assay. Expression of Gα12 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 115 and 116 of Gα12.Addition of the HA epitope at N terminus of Gα12.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUS2-SH231
Plasmid#115150PurposeCas9-GFP, dual gRNA expression vector for targeted integration of repair templates into safe harbor 231 locus in chromosome 4DepositorInsertDual SH231 gRNAs
UseCRISPRTags3xFLAG-SV40NLS, GFP, and Nucleoplasmin NLSExpressionMammalianPromoterU6, CBhAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gα11-LgB97
Plasmid#134361PurposeNanoluc complementation assay. Expression of Gα11 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 97 and 98 of Gα11. Addition of the HA epitope at N terminus of Gα11.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pet21a-aGFPnb-minimizer-cys-linker-YbbR-(PAS)5-H6
Plasmid#192789PurposeaGFP nanobody minimizer tagged with cysteine, YbbR and H6 for bacterial expression, purification and labelingDepositorInsertantiGFP nanobody minimizer
TagsH6 and ybbRExpressionBacterialAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSH231-EF1-BLST-dCas9-VPR
Plasmid#115148PurposeSafe harbor site 231 knock-in vector with BlastR-dCas9-VPR expression cassetteDepositorInsertBlastR-P2A-dCas9-VPR
UseCRISPRTagsNucleoplasmin NLS and SV40NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
LV-LIN28A
Plasmid#117057PurposeOverexpression of mouse LIN28ADepositorAvailable SinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-nsp7-nsp8
Plasmid#159092PurposeCoexpression construct of Nsp7 with an N-terminal His-tag and Nsp8DepositorInsertsNSP7
NSP8
TagsHisExpressionBacterialPromoterT7Available SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-IRG1-N152S-HA
Plasmid#198182PurposeMammalian expression of HA-tagged human ACOD1 (IRG1) N152SDepositorInsertACOD1 (ACOD1 Human)
TagsHAExpressionMammalianMutationThe asparagine in IRG1 at position 152 mutates to…PromoterCMVAvailable SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEXPqcxip-hFTSJ3-FLAG
Plasmid#165463PurposeHuman FTSJ3 retroviral mammalian expression vector. FLAG/Gateway modified pQCXIP vector with C-terminal FLAG epitope and bicistronic puromycin expression.DepositorInsertFtsJ RNA 2'-O-methyltransferase 3 (FTSJ3 Human)
UseRetroviral; GatewayTagsFLAGExpressionMammalianPromoterCMV/MSV, 5'LTRAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQ54-VC
Plasmid#175060Purposeexpresses mVenus and mCherry tagged to a mutant of the huntingtin exon1 (polyQ54) in mammalian cellsDepositorInsertpolyQ54 (HTT Human)
TagsmVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQ25-VC
Plasmid#175062Purposeexpresses mVenus and mCherry tagged to a mutant of the huntingtin exon1 (polyQ25) in mammalian cellsDepositorInsertpolyQ25 (HTT Human)
TagsmVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EGFP
Plasmid#166140PurposeEGFP expression under the control of the Galactose-inducible promoter yeast. Contains CEN/ARS element for low copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQ39-VC
Plasmid#175061Purposeexpresses mVenus and mCherry tagged to a mutant of the huntingtin exon1 (polyQ39) in mammalian cellsDepositorInsertpolyQ39 (HTT Human)
TagsmVenus + mCherryExpressionMammalianMutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK…PromoterCMV PromoterAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-ChR2-YFP
Plasmid#204345PurposePiggyBac transposon vector suitable for inserting the ChR2-YFP optogenetic actuator driven by the ubiquitous CAG promoter into the genome of mammalian cell lines.DepositorInsertChR2-YFP
TagsYellow fluorescent proteinExpressionMammalianMutationC-terminus (aa315-737) is deleted - PMID: 1461559…PromoterCAGAvailable SinceOct. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-TEVsite-human Glomulin
Plasmid#52292Purposebacterial expression of human GlomulinDepositorAvailable SinceMarch 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
p420-3
Plasmid#71257Purposeluciferase reporter with 3 copies of the GM420 NFAT-AP-1 site in front of hGM-CSF -55 to +28 minimal promoterDepositorInsert3 copies of the GM420 NFAT-AP-1 site (CSF2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterGM-CSF minimalAvailable SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only