We narrowed to 4,562 results for: abo
-
Plasmid#55761PurposeAn amino-terminal CFP Fragment was fused to residues 202-477 of RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertRGS7(202-477)-CFP(1-158) (RGS7 Human, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationThe RGS sequence amino terminal to the GGL domain…PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-10-3xFLAG-LGP2-MIIa
Plasmid#58684PurposeExpresses LGP2 with a mutation to motif IIa in mammalian cellsDepositorInsertLGP2-MIIa (DHX58 Human)
Tags3x FLAGExpressionMammalianMutationmutation to Motif IIA, K138E and Y142FPromoterCMVAvailable SinceJuly 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-IRES2-rat-Letm1
Plasmid#212661PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and rat-Letm1DepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.2 EmGFP hAQP4(M23)
Plasmid#126464PurposeExpresses human AQP4 (isoform M23) as an EmGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV-ASNS-OE-IRES-Thy1.1
Plasmid#192947PurposeAsparagine synthetase overexpression in murine cellsDepositorAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-Hygro
Plasmid#253775PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to hygromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.3 N-MYC TIP60
Plasmid#213003Purposeexpresses human TIP60DepositorAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-DEST-IRES-Neo
Plasmid#253766PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLY100-RetroEFS-HER2-28BBz-WPRE
Plasmid#192201PurposeRetro-HER2CARDepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-HIV RT-6xHis-RBS-prot
Plasmid#159149Purposeexpresses His-tagged HIV reverse transcriptase and untagged HIV proteaseDepositorInsertsHuman immunodeficiency virus 1 (HIV-1) reverse transcriptase
Human immunodeficiency virus 1 (HIV-1) protease
TagsHisExpressionBacterialMutationHIV-1 group M/subtype B – BH10 strainAvailable SinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Beta-2-adrenergic receptor-mRFP
Plasmid#67145PurposeBeta-2-adrenergic receptor tagged with mRFP on carboxyl terminusDepositorInsertBeta-2-adrenergic receptor-mRFP (ADRB2 Discosoma sp., Human)
TagsmRFPExpressionMammalianPromoterCMVAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProD1-GCaMP6s
Plasmid#126005PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVPromoterProD1Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA1-GCaMP6s
Plasmid#126002PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVPromoterProA1Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
12_pAAV-ProC2-CatCh-GFP-WPRE
Plasmid#125938PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC2Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-IRSp53-T2A-Cdc42(G12V)
Plasmid#221329PurposeDox-inducible expression of FLAG-IRSp53-T2A-HA-Cdc42 G12V in mammalian cells by retroviral transductionDepositorUseRetroviralMutationG12VPromoterTRE3GAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLY57_TRAC-LHA-pAAV-EFS-CD22BBz-PRODH2-TRAC-RHA(3166mut)
Plasmid#192188PurposeCD22 CAR AAV vector PRODH2 KI (pLY057)DepositorInsertCD22 CAR AAV vector PRODH2 KI (pLY057) (CD22 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Beta-2-adrenergic receptor-YFP
Plasmid#67146PurposeBeta-2-adrenergic receptor tagged with YFP on carboxyl terminusDepositorInsertBeta-2-adrenergic receptor-YFP (ADRB2 Human, Aequorea victoria)
TagsYFPExpressionMammalianPromoterCMVAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-ProC3-Cre/mCherry
Plasmid#126006PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCre-2A-mCherry
UseAAVPromoterProC3Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
Beta-2-adrenergic receptor-CFP
Plasmid#55794PurposeBeta-2-adrenergic receptor tagged with ECFP on carboxyl terminusDepositorInsertBeta-2-adrenergic receptor-ECFP (ADRB2 Human, Aequorea victoria)
TagsECFPExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only