We narrowed to 10,382 results for: plasmids 101
-
Plasmid#162778PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to one tyrosine sulfation (TS) motif. LaM4-1xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to a TS site, T7, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialMutationPromoterT7Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO Plk4 KD ∆24-mCherry
Plasmid#80272Purposemammalian expression plasmid for kinase dead Plk4 with multi-phospho degron deletedDepositorInsertPlk4 (PLK4 Human)
UseTagsmCherryExpressionMammalianMutationdeletion of multi-phospho degron (amino acids 282…PromoterCMVAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP104-ChromeQ-mCherry
Plasmid#123125PurposeAAV-mediated expression of ChromeQ-mCherry under the GFAP promoter.DepositorInsertChromeQ-mCherry
UseAAVTagsmCherryExpressionMammalianMutationChannelrhodopsin-2 (ChR2) with mutations A71S/ E9…PromoterGFAP104Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
SGLT2(GFP)-MAP17(nb)
Plasmid#216211Purposefor expression of human GFP-tagged SGLT2-MAP17 nanobody complex in BacMam systemDepositorUseTagsGFPExpressionMammalianMutationPromoterAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-2xTS
Plasmid#162779PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to two tyrosine sulfation (TS) motifs. LaM4-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to two TS sites, T7, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialMutationPromoterT7Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP104-ChromeT-mCherry
Plasmid#123126PurposeAAV-mediated expression of ChromeT-mCherry under the GFAP promoter.DepositorInsertChromeT-mCherry
UseAAVTagsmCherryExpressionMammalianMutationChannelrhodopsin-2 (ChR2) with mutations A71S/ E9…PromoterGFAP104Available SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChromeT-GFP
Plasmid#123316PurposeAAV-mediated expression of ChromeT-GFP under the Syn promoter.DepositorInsertChromeT-GFP
UseAAVTagsGFPExpressionMammalianMutationChannelrhodopsin-2 (ChR2) with mutations A71S/ E9…PromoterSynAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1a-mCherryLuciferase-W
Plasmid#200101PurposeLentiviral vector expressing mCherry fused with Luciferase at the C-terminusDepositorInsertLuciferase
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSBtet rtTA G72V SE Δsplice GP Luc
Plasmid#194328PurposeTetracycline inducible expression of Luciferase enzyme in mammalian cells with inclusion of rtTA G72V mutation, splice site and high sensitivity mutations for increased promotor tightnessDepositorInsertLuciferase
UseLuciferaseTagsExpressionMammalianMutationTet-responsive promotor related mutations: G72V i…PromoterTight tet-responsive promotorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVTagsExpressionMutationPromoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-T2A-mCherry-pA
Plasmid#192481PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVTagsExpressionMutationNoPromoterU6/EFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-CasRx-pa
Plasmid#233035PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVTagsExpressionMutationPromoterAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lutheran-CD4d3+4-bio
Plasmid#73101PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding Lutheran with rat CD4d3+4-bioDepositorInsertLutheran (BCAM Human)
UseTagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianMutationPromoterCMVAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-mouseAtoh1-IRES-GFP
Plasmid#73572PurposeMammalian retroviral expression of Atoh1DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
YAF2_pLX307
Plasmid#98383PurposeLentiviral expression of YAF2DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
gh142
Plasmid#106812Purposeexpression of gRNA targeting EOGTDepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
gh260
Plasmid#106851Purposeexpression of gRNA targeting ALG6DepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVTagsExpressionMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
gh149
Plasmid#106819Purposeexpression of gRNA targeting GLT1D1DepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
gh63
Plasmid#106734Purposeexpression of gRNA targeting B4GALT3DepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only