We narrowed to 5,265 results for: mos
-
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaK382R
Plasmid#62519PurposeLysine 382 of Drosha was mutated to arginineDepositorInserthuman Drosha with lysine 382 changed to arginine (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged lysine 383 to arginineAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a I18A
Plasmid#40043DepositorInserthSlp4-a I18A (SYTL4 Human)
TagsEGFPExpressionMammalianMutationIsoleucine 18 to AlaninePromoterCMV promoterAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a linker
Plasmid#40040DepositorInserthSlp4-a linker (SYTL4 Human)
TagsEGFPExpressionMammalianMutationlinker domain (144-353)PromotercmvAvailable SinceOct. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
Cre-IRES-PuroR
Plasmid#30205PurposeLentiviral coexpression of Cre and puromycin from the human EF1a promoterDepositorInsertCre recombinase (cre Enterobacteria phage P1)
UseCre/Lox and LentiviralExpressionMammalianPromoterEF1alphaAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
5` CC: Puro – loxP – GFP-C
Plasmid#219563Purpose5` circularization cassette.Used in combination with one of the 3' circularization cassettes to induce Cre-mediated circularizazion or inversion of a desired genomic region.DepositorInserthPGK-promoter_PuroR_2A_loxP_GFP-C
UseUnspecifiedPromoterhPGKAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABCG1_pcDNA6.2/EmGFP-Bsd
Plasmid#176944PurposeMammalian expression vector encoding ABCG1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-LAP-KNL1-M3
Plasmid#115896PurposeUsed for expression of siRNA-resistant KNL1-M3 (modified codons 258 and 259) from the FRT site of FlpIn cells upon addition of doxycyclin.DepositorInsertKNL1-M3 (KNL1 Human)
TagsEYFPExpressionMammalianMutationFragment of KNL1 containing three KNL1 repeat seq…Available SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN396 - pCAGGS-Tir1-V5-2A-PuroR TIGRE donor
Plasmid#92142PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse TIGRE acceptor locus using Puromycin selection (2A-fusion). Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-bpNLS-eeBxb1 (CJT555)
Plasmid#248209PurposeeeBxb1 recombinase with N-terminal bpNLS, expressed from a CMV promoter.DepositorInsertbpNLS-eeBxb1
UseCRISPR; In vitro transcriptionTagsBPNLSExpressionMammalianMutationeeBxb1(V74A, E229K, V375I)PromoterCMV and T7Available SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-FastFUCCI-IRES-myr-mTagBFP (JDW 1502)
Plasmid#242597PurposeA CAGGS driven expression vector containing FastFUCCI to label cell cycle state followed by an IRES and a membrane targeted mTagBFP2DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110)
ExpressionMammalianPromoterCAGGSAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BLAST-CMV-LiCre-WPRE (JDW 1495)
Plasmid#242594PurposeLentiviral vector with a CMV promoter driving a light inducible cre (LiCre).DepositorInsertLiCre
ExpressionMammalianPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1_SypHer3s_mito
Plasmid#238972PurposeMammalian neurons SypHer3s expression targeted to the mitochondrial matrixDepositorInsertSypHer3s
UseAAVTags3x Cytochrome C Oxidase Subunit VIII presequenseExpressionMammalianPromoterhSyn1Available SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Click editor (CE1) - pCMV-T7-PCV2-nCas9-EcKlenow (EMK488)
Plasmid#208942PurposeThe CE1 construct, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.CD19-FMC63.218.CAR-3G
Plasmid#194458PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-CD19 from FMC63 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-CD19 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1_HyPer7_mito
Plasmid#238968PurposeMammalian neurons HyPer7 expression targeted to the mitochondrial matrixDepositorInsertHyPer7
UseAAVTags3x Cytochrome C Oxidase Subunit VIII presequenseExpressionMammalianPromoterhSyn1Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.CD19-FMC63.218.CAR-2G
Plasmid#194457PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ζ (signaling domains); anti-CD19 from FMC63 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-CD19 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
IFNGR2_pcDNA6.2/EmGFP-Bsd
Plasmid#176939PurposeMammalian expression vector encoding IFNGR2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-20nmEML-mRFP
Plasmid#231181PurposeExpresses a synthetic linker, tagged with mRFP, stabilizing the ER-mitochondrial distance at 20 nm from a lentiviral vectorDepositorInsert20nmEML-mRFP
UseLentiviralPromoterCMVAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-30nmEML-mRFP
Plasmid#231182PurposeExpresses a synthetic linker, tagged with mRFP, stabilizing the ER-mitochondrial distance at 30 nm from a lentiviral vectorDepositorInsert30nmEML-mRFP
UseLentiviralPromoterCMVAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only