-
Plasmid#225956PurposeLentiviral vector plasmid expressing human CKAP4 mutant with an additional luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationFull-length CKAP4 with additional luminal domain …PromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLV-SFFV-myc-STIM1-WPRE-UbC-Emerald
Plasmid#225939PurposeLentiviral vector plasmid expressing human stromal interaction molecule 1 (STIM1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL1-WPRE-UbC-Emerald
Plasmid#225944PurposeLentiviral vector plasmid expressing human atlastin GTPase 1 (ATL1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC8B1_STOP
Plasmid#161364PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC8B1 (SLC8B1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
MEK1C218C222
Plasmid#164640PurposeBacterial expression plasmid for His6-MEK1C218C222DepositorInsertmitogen-activated protein kinase kinase 1 (MAP2K1 Human)
UseTagsHis6-tagExpressionBacterialMutationG(-19)F/S218C/S222C/C277S/C376SPromoterT7Available sinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_CLN3
Plasmid#131868PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertCLN3 (CLN3 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1951
Plasmid#105868PurposeHigh copy number plasmid containing Hspa1a (synonym Hsp68) MiniPromoter insertDepositorUseTagsExpressionMutationPromoterHsp68 MiniPromoterAvailable sinceFeb. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCW57-mCherry-2A-BRD4 Iso AdelCTD
Plasmid#137722PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long isoform missing its C-terminal, P-TEFb interacting domain (CTD)DepositorInsertBRD4 long isoform without its C-terminal, P-TEFb interacting domain (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationTruncated at amino acid 1328PromoterTight TRE promoterAvailable sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-CLN3_STOP
Plasmid#161034PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertCLN3 (CLN3 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCW57-mCherry-2A-BRD4 Iso CdelET
Plasmid#137723PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long short missing its extra-terminal domain (ET)DepositorInsertBRD4 short isoform with deleted extra-terminal domain (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationDeleted amino acids 600-682PromoterTight TRE promoterAvailable sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
ERK1C202
Plasmid#164647PurposeBacterial expression plasmid for His6-ERK1C202DepositorInsertERK1C202 (MAPK1 Human)
UseTagsHis6-tagExpressionBacterialMutationK71R/C82S/C144S/C178S/C183S/T202C/C271SPromoterT7Available sinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
ERK1C82C202
Plasmid#164650PurposeBacterial expression plasmid for His6-ERK1C82C202DepositorInsertERK1C82C202 (MAPK1 Human)
UseTagsHis6-tagExpressionBacterialMutationK71R/C144S/C178S/C183S/T202C/C271SPromoterT7Available sinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS1401
Plasmid#29198PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1538
Plasmid#29261PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving a lacZ reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable sinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEMHE-RnCENP-O-203-GFP
Plasmid#205183PurposeExpresses chimeric rat CENP-O with mouse CENP-O middle region including central RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O middle regi…PromoterT7Available sinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD Aro--
Plasmid#169716PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, aromatic amino acids.DepositorInserthnRNPA1 (HNRNPA1 Human)
UseTags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available sinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only