We narrowed to 23,320 results for: lenti
-
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2bleo-Nectin-2
Plasmid#170295PurposeA knock-out vector for the mouse Nectin-2DepositorInsertA gRNA targeting the mouse Nectin-2 gene.
UseCRISPR and LentiviralAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2bleo-Necl-5
Plasmid#170294PurposeA knock-out vector for the mouse Necl-5DepositorInsertA gRNA targeting the mouse Necl-5 gene.
UseCRISPR and LentiviralAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgACO1_3
Plasmid#169893PurposeDisrupt ACO1DepositorInsertsgRNA targeting ACO1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgSLC35B2
Plasmid#83932PurposeLentiviral vector expressing an sgRNA targeting SLC35B2 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgSLC35B2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgTPST2
Plasmid#83933PurposeLentiviral vector expressing an sgRNA targeting TPST2 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgTPST2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-2
Plasmid#83935PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-3
Plasmid#83936PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK_1
Plasmid#163462Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADKDepositorInsertsgRNA 1 targeting NADK (NADK Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSmg7
Plasmid#161809Purposeguide RNA for Smg7DepositorInsertsgRNA targeting mouse Smg7 (Smg7 Synthetic, Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA2
Plasmid#160946PurposeGuide RNA 2 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_Hu_ECT2(T327D)
Plasmid#136332PurposeLentiviral expression of human ECT2_T327DDepositorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-CENPB
Plasmid#120208PurposegRNA targeting the stem loop of CENPB poly(A) siteDepositorInsertCENPB poly(A) site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3/NS4A-2K
Plasmid#120838PurposeLentiviral expression of ZIKV proteinDepositorInsertNS4A-2K ZIKV
UseLentiviralTagsV5PromoterCMVAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3/2K-NS4B
Plasmid#120845PurposeLentiviral expression of ZIKV proteinDepositorInsert2K-NS4B ZIKV
UseLentiviralTagsV5PromoterCMVAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgAMDHD1
Plasmid#102316Purposegenetic depletion of AMDHD1DepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR sgNFS1
Plasmid#102979PurposeCutting NFS1 genomic locusDepositorInsertsgNFS1 (NFS1 Human)
UseCRISPR and LentiviralAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiN MmuPV1 E6
Plasmid#87661PurposeLentiviral expression of MmuPV1 E6DepositorInsertMmuPV1 E6
UseLentiviralTagsFlag and HAPromoterCMVAvailable SinceMarch 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-2
Plasmid#86135PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorInsertsgRNA targeting C17orf89 (NDUFAF8 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only